Birds! Bears! Bees! and all the Chimpanzees
August 2, 2011 6:24 PM   Subscribe

You are to bring into the ark two of all living creatures, male and female, to keep them alive with you.20 Two of every kind of bird, of every kind of animal and of every kind of creature that moves along the ground will come to you to be kept alive.21 You are to take every kind of food that is to be eaten and store it away as food for you and for them. (SYTL) [via]


Acamatus Acanthognathus Acanthomyops Acanthosticus Acromyrmex Adetomyrma
Aenictus Allomerus Amblyopone Amblyteles Anergates Anochetus Anonychomyr
ma Aphaenogaster Apomyrma Asphinctanilloides Atta Azteca Brachymyrmex Bo
thriomyrmex Camponotus Cardiocondyl a Carebara Cataglyphis Cephalotes Ce
rapachys Chela ner Cheliomyrmex Colobopsis Crematogaster Cryptoce rus Cy
phomyrmexDaceton Diacamma Dinoponera Diplom orium Discothyrea Doleromyrm
aDolichoderus Donisth orpea Dorymyrmex Dorylus Eciton Ectatomma Ephebomy
rmex Epoecus Epipheidole Erebomyrma Euponera Forel ius Formica Formicoxe
nusGigantiops Harpagoxenus H arpegnathos Heteroponera Holcoponera Huberi
a Hypoc linea Hypoponera Ichnomyrmex Iridomyrmex Janetia Kalathomyrmex L
asius Leptanilloides Leptogenys Lep tomyrmex Leptothorax Leucoagaricus L
inepithema Lio metopum Lobopelta Macromischa Manica Mayriella Meg aponer
a Melophorus Messor Monomorium Myrmecia Myrm ecina Myrmecocystus Myrmela
chista Myrmica Mystrium Neivamyrmex Neoponera Ochetellus Odontomachus O
eco phylla Opamyrma Orectognathus Pachycondyla Parapon era Parasyscia Pa
ratrechina Peronomyrmex Pheidole Pheidologeton Pismire Plagiolepis Plat
ythyrea Pogo nomyrmex Polyrhachus Polyergus ponera Prenolepis P robolomy
rmex Proceratium Prolasius Protomognathus Pseudomyrma Pseudomyrmex Pyra
mica Quartina Rhytid oponera RogeriaSerrastruma Solenopsis Stenamma St i
gmatomma Streblognathus Strongylognathus Strumige nys Sympheidole Sysphi
ncta Tapinoma Technomyrmex T emnothorax Tetramorium Tetraogmus Typhlomyr
mex Tyrannomyrmex Vollenhovia Wheeleriella Wasmannia Xenomyrmex Xiphomyr
mex
posted by the noob (94 comments total) 19 users marked this as a favorite

I think the official creationist line is that YHWH created a small number of ancestor species, which Noah then took onto the Ark. They later, erm... changed... into myriad modern species. But the species of today could not have evolved from a common ancestor, because the Bible says otherwise.
posted by East Manitoba Regional Junior Kabaddi Champion '94 at 6:43 PM on August 2, 2011 [2 favorites]


Right. What's a cubit?
posted by not_on_display at 6:45 PM on August 2, 2011 [40 favorites]


Yeah, Cosby has the best take on this, in my opinion, not_on_display.
posted by joe lisboa at 6:46 PM on August 2, 2011


The script is here, for those who can't (or don't want to) watch the videos.
posted by vidur at 6:48 PM on August 2, 2011


Right. What's a cubit?

Wasn't that the form of currency on Battlestar Gallactica?
posted by birdherder at 6:48 PM on August 2, 2011 [3 favorites]


Biblical literalism is heretical.
posted by koeselitz at 6:52 PM on August 2, 2011 [8 favorites]


The script is here, for those who can't (or don't want to) watch the videos.

Dang, that was meant to be the "via" link. Accursed clipboard.

thanks vidur
posted by the noob at 6:55 PM on August 2, 2011


I watched the whole thing. It was a little long but worth the time (slow night around here). I asked a lot of those questions about this in Sunday School when I was a little kid, but I never really thought of the logistics in the scale presented here.

For you young'uns out there that maybe never heard it, here's the Cosby routine. VOOBAA VOOBAA

And here's my Noah's Ark photo.
posted by marxchivist at 6:56 PM on August 2, 2011 [6 favorites]


Mark Twain -- Letters From The Earth -- This is his account of Noah and The Ark, some of the richest writing I've ever come across, brilliant, scathing. Twain is a hero of mine.
posted by dancestoblue at 6:59 PM on August 2, 2011 [8 favorites]


I know, horadic cubes and a pouch of accessibility.
posted by clavdivs at 7:03 PM on August 2, 2011 [1 favorite]


This is excellent.
posted by chemoboy at 7:11 PM on August 2, 2011


It's easy to make fun of the bible.

Because it's so stoooooooooooooooooooooooooooooooooooooopid.
posted by hexatron at 7:14 PM on August 2, 2011 [9 favorites]


Ricky Gervais on Noah's Ark, from his childhood Sunday School book.
posted by misha at 7:17 PM on August 2, 2011


Ricky Gervais on Noah's Ark

"This video has been removed by the user."

Poopsticks.
posted by That's Numberwang! at 7:26 PM on August 2, 2011


It amuses me that so many non-Christians waste so much time on this stuff.
posted by oddman at 7:28 PM on August 2, 2011 [2 favorites]


Right. What's a cubit?

My favorite ark fact is what it's made of. You might know that it's "gopher wood". But what's gopher wood? Nobody knows. The word in the Bible is "גפר", (gofer), which doesn't appear any where else in all the Hebrew text, or anywhere else in the Bible, either (which makes it a hapax legomenon).

I think it's kind of sneaky to write it as "gopher wood". It makes it looks like we know what it means, but we don't
posted by benito.strauss at 7:29 PM on August 2, 2011 [18 favorites]


Wow, those are long, tedious, and preachy.
posted by Curious Artificer at 7:29 PM on August 2, 2011 [1 favorite]


Gopher wood?

Somehow this should have worked its way into Caddyshack.
posted by Clyde Mnestra at 7:33 PM on August 2, 2011 [2 favorites]


Ricky Gervais on Noah's Ark

"This video has been removed by the user
."


Is this what you're looking for?
posted by ricochet biscuit at 7:35 PM on August 2, 2011


It amuses me that so many non-Christians waste so much time on this stuff.

It scares the fuck out of me that so many Christians take this stuff seriously.
posted by joe lisboa at 7:41 PM on August 2, 2011 [32 favorites]


Wow, those are long, tedious, and preachy.

What, the original source material? Yes.
posted by joe lisboa at 7:43 PM on August 2, 2011 [3 favorites]


Then there's the version where there are 14 of all the animals. (The clean ones anyway.)
posted by CheeseDigestsAll at 7:44 PM on August 2, 2011


I think the official creationist line is that YHWH created a small number of ancestor species, which Noah then took onto the Ark. They later, erm... changed... into myriad modern species. But the species of today could not have evolved from a common ancestor, because the Bible says otherwise.

I've heard this one, but I'm not sure it's all that widely accepted.

Biblical literalism is remarkably bad at settling on an official line for anything.

This is probably not surprising, but it's still funny.
posted by brennen at 7:49 PM on August 2, 2011 [2 favorites]


This is probably not surprising, but it's still funny.

Yeah, but do not dare comment on this. You have been warned.
posted by joe lisboa at 7:50 PM on August 2, 2011


It amuses me that so many non-Christians waste so much time on this stuff

I'm amused in my time wasting - so time well wasted. I could waste more time on it by taking it seriously.
posted by the noob at 7:51 PM on August 2, 2011 [1 favorite]


The Ark would have created a unique manure mixture if nothing else.
posted by jonmc at 7:52 PM on August 2, 2011 [1 favorite]


The ark started moving, it drifted with the tide
The unicorns looked up from the rocks and they cried
And the waters came down and sort of floated them away
That's why you never see unicorns to this very day
posted by mr_crash_davis at 7:56 PM on August 2, 2011 [9 favorites]


That was kind of an awesome intersection of comments.

Also, the Cosby routine is fantastic. I'd kind of forgotten about it 'til now, but we listened to it constantly as kids. Informed my view of the whole thing in ways I probably wasn't even aware of at the time.
posted by brennen at 7:57 PM on August 2, 2011


brennen: “Biblical literalism is remarkably bad at settling on an official line for anything.”

I said above that I believe that Biblical literalism is heretical, and I meant it – literalism is not and has never been the teaching of the church (or of Judaism for that matter).

However, I should point out that Biblical literalism actually has a simple and painfully difficult to answer line for everything – "it was a miracle." "God made it that way." I mean it when I say that's painfully difficult; personally, I find it quite disturbing, because there is really no rational answer for this. It really might have been a miracle. And there is no logical, rational, scientific way to prove that it wasn't.
posted by koeselitz at 7:58 PM on August 2, 2011 [2 favorites]


What the creationists actually do is that they go crazy over the word 'kind' and create baraminology.
posted by benito.strauss at 8:00 PM on August 2, 2011


... I mean, the trouble is that, while I see the argument ensconced in this video and the Ricky Gervais bit – the argument that "hey, this doesn't make rational sense! It's not possible by the laws of physics, genetics, and everything else!" – it sort of melts in the face of an argument based on miracles.

If God can do impossible things, it really doesn't matter if the whole thing seems improbable, inconsistent, and contradictory. Maybe life is contradictory. Maybe God made it that way. Maybe there is no possible way this could have occurred – still, an all-powerful God could have made it happen.

I know that this is utterly unsatisfactory to a thoughtful person (like myself) who would like to believe in the power of human cognition to attain knowledge. But the fact that it's unsatisfactory doesn't change the fact that the argument from miracles can't really be quashed rationally.
posted by koeselitz at 8:08 PM on August 2, 2011 [2 favorites]


I said above that I believe that Biblical literalism is heretical, and I meant it – literalism is not and has never been the teaching of the church (or of Judaism for that matter).

Here, I think it really depends on what you mean by "the church". For some values of that phrase - Roman Catholicism, the Orthodox traditions, etc., the Church with a big C - I'll grant the point, but I have encountered quite a lot of self-described Biblical literalism in various churches, and I'm pretty sure the strain of thinking has been around for a while.

What I was getting at, I guess, is that no two collections of people who understand themselves to believe, literally, every line of the Bible (and there are a fair number of these people) ever seem to concur on the particulars. A fact unsurprising to most people who don't have a stake in the Word as unyielding absolute, independent of the mere understanding of the reader, etc., but not likely to get you very far in conversation with those who have bought in.

I agree that there's usually sort of an observable "BECAUSE GOD SAID SO" line, beyond which reason seems to totally evaporate.
posted by brennen at 8:10 PM on August 2, 2011 [1 favorite]


But the fact that it's unsatisfactory doesn't change the fact that the argument from miracles can't really be quashed rationally.

Thought Hume had a pretty good (albeit not flawless) response to this line of argument, though. No?
posted by joe lisboa at 8:10 PM on August 2, 2011 [2 favorites]


However, I should point out that Biblical literalism actually has a simple and painfully difficult to answer line for everything – "it was a miracle." "God made it that way." I mean it when I say that's painfully difficult; personally, I find it quite disturbing, because there is really no rational answer for this. It really might have been a miracle. And there is no logical, rational, scientific way to prove that it wasn't.

It's like the religious equivalent of "a wizard did it."
posted by NoraReed at 8:11 PM on August 2, 2011 [6 favorites]


So let me get this straight, society now is composed of Christians vs everybody else? War is declared! Is that right, because I didn't get the official notice.
posted by Senator at 8:16 PM on August 2, 2011


Just consider the Ark like a TARDIS. It's bigger inside than out.
posted by misha at 8:17 PM on August 2, 2011 [6 favorites]


So let me get this straight, society now is composed of Christians vs everybody else? War is declared! Is that right, because I didn't get the official notice.

Speaking as the resident asshole in this thread, allow me to say that this comment is totally unhelpful and not terribly conducive to a conversation that arguably has been un-derailed.
posted by joe lisboa at 8:18 PM on August 2, 2011 [1 favorite]


So let me get this straight, society now is composed of Christians vs everybody else? War is declared! Is that right, because I didn't get the official notice.

Senator, i think that after 1500 years or so of rigidly imposed dogma the odd critique is long over due. I think it s a bit of a stretch calling discourse a war.
posted by the noob at 8:19 PM on August 2, 2011 [2 favorites]


Just consider the Ark like a TARDIS. It's bigger inside than out.

And both captains are literally hundreds of years old!
posted by joe lisboa at 8:20 PM on August 2, 2011


Thought Hume had a pretty good (albeit not flawless) response to this line of argument, though. No?

I think the problem (and I just experienced this a couple of days ago, ill-advisedly arguing with a guy I've known for decades about whether we could reason about the possibility that human cognition evolved) is that at some point, it's just not a line of formal argument or reasoning or discussion. It's a deep emotional response. It might take the form of something intellectualized, some sort of logical proposition, but eventually there's just a this-far-and-no-further.

As I think koeselitz hinted, if you don't think things are knowable, or don't think they're knowable outside of the "literal" meaning of a given single text, that tends to be where discourse stops.
posted by brennen at 8:20 PM on August 2, 2011


It really might have been a miracle. And there is no logical, rational, scientific way to prove that it wasn't.

Even if one feels that the possibility cannot be discounted, it is clearly irrational to embrace it as a certainty, or even as a probability, when there is no good evidence in its favor, and while earthly explanations suffice.
posted by East Manitoba Regional Junior Kabaddi Champion '94 at 8:21 PM on August 2, 2011 [3 favorites]


I grasp your larger point, brennen, but is there really any doubt among serious people that human cognition evolved?
posted by joe lisboa at 8:21 PM on August 2, 2011


EMRJKC94: “Even if one feels that the possibility cannot be discounted, it is clearly irrational to embrace it as a certainty, or even as a probability, when there is no good evidence in its favor, and while earthly explanations suffice.”

Maybe life is irrational. Maybe that's just how the world works.
posted by koeselitz at 8:22 PM on August 2, 2011


Maybe life is irrational. Maybe that's just how the world works.

There is a Nietzsche quote on the tip of my tongue to this effect. Damn if I can recall it at the moment. Something about the will to truth being itself (grounded in) error. Sorry, long day. Drawing a blank.
posted by joe lisboa at 8:26 PM on August 2, 2011


Maybe life is irrational. Maybe that's just how the world works.

So what if it is? I mean, if life is irrational in the way you describe, so that explanations of events are impossible, because everything has only one explanation, the irreducible will of God, then... what? In that world, what does it matter whether you understand the truth about how the universe works? In that world, what does it even mean to understand something?
posted by stebulus at 8:29 PM on August 2, 2011


I grasp your larger point, brennen, but is there really any doubt among serious people that human cognition evolved?

Well, if we're talking about intellectually credible people with domain knowledge, I think not so much.

On the other hand, a lot of people I take pretty seriously as people think evolution is a ridiculous - or maybe it'd be more accurate to say evil - idea. I grew up in the sticks, so maybe I know more of these people than is average, even in America, but there are a lot of them out there in the world. And most of them aren't fools, or willingly bad actors, or even necessarily that badly informed about a lot of the world. They're just running around with a broken conceptual model. Unfortunately, their model is something we all have to deal with one way or another.
posted by brennen at 8:30 PM on August 2, 2011


Unfortunately, their model is something we all have to deal with one way or another.

I call that an occupational hazard :) Point taken.
posted by joe lisboa at 8:31 PM on August 2, 2011


Man, I hear more about religion on mefi than I did when I was going to Catholic school.
posted by desjardins at 8:34 PM on August 2, 2011 [12 favorites]


[Please go to MetaTalk or email your complaints to us directly if you've got a problem. Shitting in other people's threads is considered poor form. Thank you.]
posted by jessamyn at 8:36 PM on August 2, 2011


Well, said, koeselitz.
posted by rmmcclay at 8:51 PM on August 2, 2011


Maybe life is irrational. Maybe that's just how the world works.

In practice, true believers embrace rationality whenever it supports their premise. When necessary, they fudge the numbers and feign rationality, so their premise appears rational. They only openly reject rationality as a last resort. The human brain loves cause and effect.
posted by East Manitoba Regional Junior Kabaddi Champion '94 at 8:52 PM on August 2, 2011 [1 favorite]


EMRJKC94: “In practice, true believers embrace rationality whenever it supports their premise. When necessary, they fudge the numbers and feign rationality, so their premise appears rational. They only openly reject rationality as a last resort. The human brain loves cause and effect.”

Indeed. I've always thought that even Eric Hoffer was a True Believer. The trouble is that, at a basic level, it's very hard to separate "True Believers" from the rest of humanity – the human brain loves cause and effect, but that's because we love explanations.

And if the human brain loves cause and effect, what if the human brain is wrong? Al-Ghazali made the argument once (though I don't know if he actually believed it) that knowledge of cause and effect, along with the rationality of the world, are miraculous gifts from god, and that without them the world may well make no sense whatsoever. While that may seem an odd explanation, I hardly see any other explanation for the rationality of the world that makes any sense at all.
posted by koeselitz at 9:01 PM on August 2, 2011


Just so long as we're clear that most of these fun suppositions about the ultimate basis of our realities are unfalsifiable, and thus scientifically vacuous ....
posted by benito.strauss at 9:06 PM on August 2, 2011


"...and that is why we have the theory of natural selection, or, in short, evolution."

"Oh YEAH? So where's them FOSSILS?"

"There are millions of fossils catalogued in museums and laboratories all over the world. But while we're on the subject, where's the Ark?"

"THEY FOUND SOMETHING ON A MOUNTAIN SOMEWHERE THAT THEY SAID MIGHT LOOK A LITTLE BIT LIKE WOOD!"
posted by tumid dahlia at 9:11 PM on August 2, 2011 [3 favorites]


benito.strauss: “Just so long as we're clear that most of these fun suppositions about the ultimate basis of our realities are unfalsifiable, and thus scientifically vacuous ....”

Maybe life is unfalsifiable.

Yeah, it's annoying. But these are possibilities that unfortunately come naturally with pronouncements like "your irrational belief structure is less valid than my rational belief structure."
posted by koeselitz at 9:15 PM on August 2, 2011


Ah. My comment about scientific vacuity is what came naturally to me from pronouncements like "It really might have been a miracle. And there is no logical, rational, scientific way to prove that it wasn't."

(BTW, I happen to believe that many important parts of my life are not repeatable experiments, so not really susceptible to the scientific method. YMMV)
posted by benito.strauss at 9:24 PM on August 2, 2011


Heh, people resorting to explicitly abandoning rationality altogether over a thread about Noah's freakin' ark. I think that counts as surrender, even if they don't realize it.
posted by smcameron at 9:35 PM on August 2, 2011 [2 favorites]


Maybe life is unfalsifiable.

What do you even mean by this?
posted by adamdschneider at 10:10 PM on August 2, 2011 [4 favorites]


Right. What's a cubit?

The apocryphal ancestor of the Q*bert. It was chased around the ark by a purple snake until it leapt to freedom.
posted by homunculus at 10:25 PM on August 2, 2011 [3 favorites]


I have sorta a Noah's Ark idea. Once cloning gets really advanced couldn't we keep genetic samples of every species on Earth? Then it doesn't matter what we do to the living animals, since we could recreate them.
posted by Lovecraft In Brooklyn at 10:34 PM on August 2, 2011


I have sorta a Noah's Ark idea. Once cloning gets really advanced couldn't we keep genetic samples of every species on Earth? Then it doesn't matter what we do to the living animals, since we could recreate them.

I'm sure this will work out swimmingly once we figure out the minor details of surviving an anthropogenic mass extinction with technological civilization intact.
posted by brennen at 10:59 PM on August 2, 2011 [1 favorite]


Living animals transmit culture / memetic material that does not exist in the genes.
posted by Meatbomb at 11:01 PM on August 2, 2011


I'm sure this will work out swimmingly once we figure out the minor details of surviving an anthropogenic mass extinction with technological civilization intact.

Surviving? We'd be the ones choosing which species live and die.
posted by Lovecraft In Brooklyn at 11:02 PM on August 2, 2011


GATGAGTTCGTGTCCGTACAACTGG GTCATCAAGCTCCTCTTTCA TCACGGTTCAGTTGTTCACC GATGAGTTCG TGTCCGTACA ACTGGCGTAA TCATGGCCCT TCGGGGCCAT TGTTTCTCTG TGGAGGAGTC CATGACGAAA GATGAACTGA TTGCCCGTCT CCGCTCGCTG GGTGAACAAC TGAACCGTGA

Ok, Aardvark.

mr_crash_davis - I loved that song when I was younger. It was happy and everyone was scrubbed clean and Irish, probably cutting up bars of soap in the back with pocket knives, and then I grew up a bit and realized the Unicorns had been beached and consigned to oblivion and the happy sounding chorus started right back up and I bawled until my mom asked what was wrong and I said the unicorns. She tried to tell me it was a happy song. Nuh uh.
posted by Smedleyman at 11:14 PM on August 2, 2011 [1 favorite]


"Living animals transmit culture / memetic material that does not exist in the genes."

That's true. We're only just starting to understand epigenetics, but there's a whole lot of information encoded outside of DNA. In the past I've thought about Lovecraft In Brooklyn's idea in relation to populating other worlds, and it seems like we'd need two technologies that don't exist yet:

1. The ability to sequence DNA (and maybe epigenetic factors), and store this information in electronic form. With that we could make an archive of the genetic information of every species on Earth, with thousands of examples of each species. This would be a lot of information, but with the way storage space is expanding it might be doable. Collecting the DNA sequences would take quite a while, though. It might even take centuries of dedicated work.

2. The ability to construct DNA sequences atom by atom from the archive, slip them into some generic cells and clone up any living creature we'd like. This is way beyond our current abilities, but doesn't sound fundamentally impossible.

With those technologies you could churn out living creatures and throw them onto the surface of a depopulated planet. Most would die, but we'd learn more from each run, and after many such runs enough species would finally "stick" to provide a critical mass that would sustain the rest.
posted by Kevin Street at 11:18 PM on August 2, 2011 [1 favorite]


You'd probably have to start with some of the oldest "pioneer" species like cyanobacteria and algae, wait for them to do the hard work of colonizing bare rock and empty water, then work your way up the tree of life to things like corals and plants - and only at the end introduce the animals. Noah must have had a tough time releasing all those species at once on a sterile Earth.
posted by Kevin Street at 11:29 PM on August 2, 2011


Al-Ghazali made the argument once (though I don't know if he actually believed it) that knowledge of cause and effect, along with the rationality of the world, are miraculous gifts from god, and that without them the world may well make no sense whatsoever. While that may seem an odd explanation, I hardly see any other explanation for the rationality of the world that makes any sense at all.

I will concede that it is odd (and even more delightful for that reason), but in what sense is it an explanation?

More generally, in what sense can the rationality of the world be explained at all? How would you tell the difference between a successful explanation and a random sequence of words? The difference is that the explanation makes sense, right? But how can you judge whether it makes sense, when the issue at stake is exactly whether anything ever makes sense, whether "making sense" is a real thing?
posted by stebulus at 11:42 PM on August 2, 2011 [2 favorites]


Maybe life is irrational. Maybe that's just how the world works.

So why bother to post these sentences? Why not just pour spaghetti sauce on your keyboard and them take a stroll out your window? I believe reality consists of more than just scientific materialism, but that's different than just talking up anything goes absurdities and then play the god card when you get called on it
posted by crayz at 11:47 PM on August 2, 2011 [3 favorites]


Surviving? We'd be the ones choosing which species live and die.

I can't think of a single human undertaking where the law of unintended consequences holds greater sway than in the engineering of ecosystems. Get back to me when the species has mastered government, software, and traffic jams.
posted by brennen at 11:54 PM on August 2, 2011 [1 favorite]


Once cloning gets really advanced couldn't we keep genetic samples of every species on Earth?

We're working on it.
posted by twirlip at 12:15 AM on August 3, 2011


Lovecraft In Brooklyn: "Surviving? We'd be the ones choosing which species live and die."

We're already doing that. Unfortunately, we've decided that they are all going to die.
posted by dg at 12:16 AM on August 3, 2011 [5 favorites]


>Is this what you're looking for?
posted by ricochet biscuit at 10:35 PM on August 2



The toucans are talking.

"Noah is a time traveler and his Ark is a spaceship equipped for taking two samples (XX+XY) of every living thing -- into outer space. How else do you explain this absurd story lasting thousands of years on Earth? And talking toucans! Pffft."

(Toucans can't actually make any of the teeth + lips+ tongue sounds)

"Pffft!" The toucan says.

Elephants snort back in disapproval. "TELL EVERYONE WHY DONTCHA!!"
Camels turn their heads to the side and spit.
Ostriches whip their necks back. "Keep it down, Heavy!"
Lions are all like "WTF?"
Dogs and kittehs take the frontline.

"We getting a lift or what?!" Toucan says.
posted by at the crossroads at 12:32 AM on August 3, 2011


Yeah, it's annoying. But these are possibilities that unfortunately come naturally with pronouncements like "your irrational belief structure is less valid than my rational belief structure."

Actually it's not annoying at all, the idea that nothing can be rationally understood because "life" may be irrational. Paraphrased in just the right way, Goedel's major life work is a proper formulation of just such a condition.

What is annoying is the sophmoric formulation that maybe "life is irrational" repeatedly advanced by a discussant as if this is an insurmountable argument that must be addressed if we are going to expose the scientific implausibility of a religious text.

In other words, koeselitz, Biblical literalism is hysterical.
posted by mistersquid at 3:00 AM on August 3, 2011


I like to think that the original story was some dude with a wagon and two sheep in it who survived a local flood that wiped out his neighbors. Every time he told the story at the local watering-hole, well, he added a few details.
posted by emjaybee at 3:33 AM on August 3, 2011 [11 favorites]


I believe koeselitz's point is that the absolute best result you can achieve with a rational critique of biblical literalism is to get the biblical literalist to reveal that their belief system is irrational, and that they see nothing wrong with this.
posted by LogicalDash at 4:38 AM on August 3, 2011 [2 favorites]


My Father-in-Law is a Bible literalist. He has told me on more than one occasion that if he starts doubting the truth of one part of the Bible then he will have to doubt the truth of all of it. That can't happen because then his faith will crumble. Therefore it is all true-- every word.

I occasionally enjoy pointing out inconsistencies to get his take on the matter, but after a while it starts feeling like bullying a child. No amount of logic or scientific fact will sway his thinking, and if he ever should lose his faith I will feel bad.
posted by Secret Life of Gravy at 5:25 AM on August 3, 2011 [1 favorite]


...is there really any doubt among serious people that human cognition evolved?

What's cognition?

I believe koeselitz's point is that the absolute best result you can achieve with a rational critique of biblical literalism is to get the biblical literalist to reveal that their belief system is irrational, and that they see nothing wrong with this....

My Father-in-Law is a Bible literalist. He has told me on more than one occasion that if he starts doubting the truth of one part of the Bible then he will have to doubt the truth of all of it. That can't happen because then his faith will crumble. Therefore it is all true-- every word.


So, the problem with your chinese room is that you need two biblical literalists to attempt to hash out the literal truth of the bible. The unavoidable conclusion then becomes that every word is true but no one knows what they mean: agnosticism is the only true bible-based church.
posted by ennui.bz at 5:59 AM on August 3, 2011 [1 favorite]


If you have any interest in seeing these things in action, there is a proposed Theme P-Ark called Ark Encounter. It is to be a full-sized replica of the Ark located in glorious Kentucky. This is, of course, sponsored by the same group of biblical literalists who have designed the wonderfully kitschy "Creation Museum." I visited in May, and I have to say that the trip was totally worth it.

These folks are the REAL deal. Genesis retconned with allusions to marriage between one-man-one-woman. (Including my very favorite museum exhibit featuring Eve barefoot and pregnant.) Intelligent Design presented via "educational" materials for all the homeschoolers who bring their children with them to see The Truth. Each display done with a tone of "silly scientists; they can't help themselves." And... best of all... dinosaurs on the ark. Oh yes. Dinosaurs on the ark. After all, there are some inescapable truths when you just can't deny the fossil record any further.
posted by jph at 6:54 AM on August 3, 2011


I like to think that the original story was some dude with a wagon and two sheep in it who survived a local flood that wiped out his neighbors. Every time he told the story at the local watering-hole, well, he added a few details.

You may not be too far off, in all seriousness.

Teh Bible (tm) as we know it today started out as a random bunch of texts that were all floating around for centuries, but some religious communities used things that other groups didn't; and religous leaders finally formalized which books and texts were in or out sometime between 200 BC - 200 AD. And all of those texts had gotten their start as oral histories. So the story of Noah's ark had been kicking around, in one form or another, for centuries.

Also, consider: just last year, a pair of archeologists came up with a theory that there was a rapid flood in the area of the Black Sea -- one which may have planted the seeds of both the Biblical Flood myth and the flood mentioned in the epic of Gilgamesh, as well as a couple of other "and then there was a great flood" stories in Greek and Hindu mythology as well. It's admittedly up for debate just how rapid and widespread that flood actually may have been, but it was at least bigger than normal, and if you take a "how we escaped from a great big flood" story and give it a few hundred years to get told and retold, that story will have a way of growing pretty epic, and then it gets written down as a Grand Epic Tale, and before you know it people at the First Council of Nicea are including it in the Bible because someone says you can see it as an allegory for God's forgiveness or something.
posted by EmpressCallipygos at 6:58 AM on August 3, 2011 [2 favorites]


Argh -- sorry, it wasn't just LAST year that the theory for a Black Sea deluge came from, that was suppsoed to be "just a few years ago." I'm still slightly pre-caffinated.
posted by EmpressCallipygos at 6:59 AM on August 3, 2011


The problem with the "it was a miracle" argument is that the story puts too much emphasis on the details of the ark. A truly miraculous version would have Noah gathering all the animals to his house which wa then surrounded by a glowing force field which kept the water away.
posted by CheeseDigestsAll at 7:25 AM on August 3, 2011 [1 favorite]


I mean it when I say that's painfully difficult; personally, I find it quite disturbing, because there is really no rational answer for this. It really might have been a miracle. And there is no logical, rational, scientific way to prove that it wasn't.

To be fair, though, it's usually considered impossible to disprove negative propositions, and that's not limited to religion.
posted by clockzero at 7:45 AM on August 3, 2011


And by that of course I mean to prove negative propositions. Yikes.
posted by clockzero at 7:46 AM on August 3, 2011


So one could just as easily say, Well, clearly Krishna did it, or (to use an irreverent example) that the flying spaghetti monster did it, and those claims would not be any less formally valid.
posted by clockzero at 7:48 AM on August 3, 2011


The lack of evil ducks is still unexplained.
posted by maryr at 8:05 AM on August 3, 2011


Once cloning gets really advanced couldn't we keep genetic samples of every species on Earth? Then it doesn't matter what we do to the living animals, since we could recreate them.

Ick.
posted by benito.strauss at 8:18 AM on August 3, 2011


Once cloning gets really advanced couldn't we keep genetic samples of every species on Earth? Then it doesn't matter what we do to the living animals, since we could recreate them.
---
Ick.
posted by benito.strauss at 8:18 AM on August 3 [+] [!]


Oh no, nothing crazy - I'm sure he just means 'eat their faces and have sex with the carcasses' or something.
posted by FatherDagon at 8:45 AM on August 3, 2011 [1 favorite]


I thought the video was funny.
posted by TheRedArmy at 8:53 AM on August 3, 2011


Surviving? We'd be the ones choosing which species live and die.

Like how we decided the bluefin tuna will live because it's so delicious, but we decided that the rats will all die off because they're pests.
posted by Hoopo at 9:33 AM on August 3, 2011 [2 favorites]


Thought Hume had a pretty good (albeit not flawless) response to this line of argument, though. No?

I've always found it deeply unsatisfying. There are diseases more rare than false positives in the tests that detect them. By Hume's logic, we should throw up our hands and declare there's no point in trying to test for those diseases.
posted by straight at 10:41 AM on August 3, 2011


"Like how we decided the bluefin tuna will live because it's so delicious, but we decided that the rats will all die off because they're pests."

The solution, of course, is to genetically modify rats so they taste like bluefin tuna. Then we'll never run out!

The point above about not using scientific fixes as a license to rape and pillage the natural world is well taken. The Earth's biosphere is vast and incredibly complex, and there's no way we could recreate it perfectly even if we did have the technology to create a scientific version of Noah's Ark. It would be nice to have a genetic archive, though, if only to bring back the occasional extinct species.
posted by Kevin Street at 1:15 PM on August 3, 2011


The solution, of course, is to genetically modify rats so they taste like bluefin tuna. Then we'll never run out!

I like the idea of walking home, seeing a little scurrying from the corner of my eye. I pounce, grab, and hold my prey up high. "Sushi Tonight!"
posted by benito.strauss at 1:20 PM on August 3, 2011 [1 favorite]


The ark started moving, it drifted with the tide
The unicorns looked up from the rocks and they cried
And the waters came down and sort of floated them away
That's why you never see unicorns to this very day
posted by mr_crash_davis at 7:56 PM on August 2 [7 favorites +] [!]


Wow, thanks for the flashback!
posted by smartypantz at 3:51 PM on August 3, 2011


Fish in a barrel and all that, but that was funnier than I expected.
posted by Decani at 11:21 AM on August 4, 2011


« Older Chris Burden's kinetic sculpture Metropolis II: 11...  |  Neil Fraser has an infrequentl... Newer »


This thread has been archived and is closed to new comments