Advertise here: Contact FM.


But have you really put any thought into that list?
January 15, 2009 1:45 PM   RSS feed for this thread Subscribe

Top 10 Science Fiction Flicks For The Thinking Man (beerandscifi version) - The Portland based blog (with a very admirable focus) takes on the Rotten Tomatoes list with a less dull alternative. (via)
posted by Artw (102 comments total) 34 users marked this as a favorite

Colossus: The Forbin Project (1970)

(may also be enjoyed by The Thinking Lady)
posted by Auden at 1:55 PM on January 15 [1 favorite has favorites]


Amazing, of all possible films you pick that one and then you go on to uncaringly oppress the Think-bots with your words.
posted by Artw at 1:59 PM on January 15


Glad to see Gattaca and Primer on the list.
posted by spikeleemajortomdickandharryconnickjrmints at 2:07 PM on January 15


fwiw, i'm happy to see Primer in both lists.
posted by shmegegge at 2:08 PM on January 15 [2 favorites has favorites]


... however, you would be surprised at how many people have not seen this movie. If you haven’t, I think you should do yourself a favor and see it.

Ye gods.
posted by ricochet biscuit at 2:10 PM on January 15 [1 favorite has favorites]


I've never even heard of Primer [IMDB] , but apparently, I'm definitely in its demographic).

"The budget for the entire film was around $7000. Most of the money was spent on film stock."
posted by Auden at 2:13 PM on January 15


Hey, "Dark City" was on the RT list.

Man, that movie's good.
posted by middleclasstool at 2:21 PM on January 15 [2 favorites has favorites]


I'da kept Blade Runner on the list, but other than that I actually almost agree with an internet list, for once, though I'm not a big Sci Fi fan, in general. I would probably put The Wrath of Khan on a list were I to make one, mostly as a nod to the whole Trek industry, as its pinnacle, but then, I haven't seen a couple movies on the list.
posted by Devils Rancher at 2:26 PM on January 15


How could anyone not have seen Gattaca? They show it in schools, for fucks sake. I saw it twice in school, once in middle school and again in high school.
posted by Caduceus at 2:26 PM on January 15


"Silent Running", anyone?
Thoughtful, understated, melancholy. Forget the scientific implausibilities and immerse yourself in this 2001-like lament on man's disregard for nature. Directed by special effects wizard Douglas Trumbull, the effects are above-average for its time but doesn't overwhelm the movie.--Scifi movie page
And Joan Baez sings the theme song.
posted by No Robots at 2:30 PM on January 15 [1 favorite has favorites]


Zardoz.
posted by autodidact at 2:31 PM on January 15 [9 favorites has favorites]


I was glad to see Primer on both lists. It's probably my favorite science fiction movie. Although I would go with Solaris over Stalker.
posted by pombe at 2:35 PM on January 15


A boy and his Dog was Don Johnson's greatest role, but I liked the dog better in it.

It was a pretty good flick though.
posted by Eekacat at 2:39 PM on January 15


The Green Man Group?
posted by ZenMasterThis at 2:41 PM on January 15


gattaca is many kinds of awesome, but it's weird how little love the sequel, TTAGCATTGGCATATCGAGCGTATGGC, got.
posted by doobiedoo at 2:42 PM on January 15 [4 favorites has favorites]


Adding Primer to my queue right now.
posted by yeti at 2:45 PM on January 15


I'm watching Blade Runner right now!
posted by fearfulsymmetry at 2:47 PM on January 15


I was really surprised by Zardoz, after considering it a baffling joke for many years. It's a very interesting film - and starring a Charlotte Rampling in her prime, which I, as a Thinking Man, certainly enjoyed.
posted by Auden at 2:47 PM on January 15


I've had Stalker in my queue for a long time now, I guess I should get around to watching it.

It is based on the short story that the recent S.T.A.L.K.E.R. games are also (loosely) based on, which is how I found out about it.

Can anyone personally recommend it?
posted by utsutsu at 2:56 PM on January 15


I've watched and loved it. Be prepared for a very slow-paced movie, lots of dialogue. If you're not down with that, avoid it. Otherwise, I think you'll be pleased.
posted by middleclasstool at 2:57 PM on January 15


La Jetée! where is La Jetée!!?
posted by joelf at 3:06 PM on January 15 [2 favorites has favorites]


^ That's what I was trying to remember... Twelve Monkeys / La Jetee
posted by autodidact at 3:08 PM on January 15


Dark City is no The Matrix...
posted by Artw at 3:09 PM on January 15


Stalker? No I'm sorry just no. I love Tarkovsky, but Stalker is not good.


In an interview on the MK2 DVD, the production designer, Rashit Safiullin, recalls that Tarkovsky spent a year shooting a version of the outdoor scenes of Stalker. However, when the crew got back to Moscow, they found that all of the film had been improperly developed and their footage was unusable. The film had been shot on experimental Kodak stock with which Soviet laboratories were unfamiliar.

Even before the film stock problem was discovered, relations between Tarkovsky and the first cinematographer, Georgy Rerberg, had been in serious deterioration. After seeing the poorly-developed material, Rerberg left the first screening session and never came back. By the time the film stock defect was found out, Tarkovsky had shot all the outdoor scenes, and had to burn them. Safiullin contends that Tarkovsky was so despondent that he wanted to abandon further production of the film.

After the loss of the film stock, the Soviet film boards wanted to shut the film down, officially writing it off. But Tarkovsky came up with a solution: he asked to make a two-part film, which meant additional deadlines and more funds.
Tarkovsky ended up re-shooting almost all of the film with a new cinematographer, Aleksandr Knyazhinsky. According to Safiullin, the finished version of Stalker is completely different to the one Tarkovsky originally shot.

That last bit goes along way to explaining why a master like Tarkovsky would release such a shitty picture. Solaris is a much better bit of sci-fi
posted by nola at 3:11 PM on January 15


Thank goodness for Netflix!
posted by buzzbash at 3:21 PM on January 15


Egads, is there a scene in Creation of the Humanoids set inside a factory where they're turning humans into robots? Because if there is, that sucker gave me nightmares for years.
posted by Joey Michaels at 3:30 PM on January 15


Dark City is no The Matrix...

Sort of in the same way that Alphaville is no Gattaca.
posted by sfenders at 3:46 PM on January 15 [1 favorite has favorites]


Primer is easily the best sci-fi movie ever. I tell everyone I know to see that movie, and then regret it because I go on and on about good it is and instantly become Creepy Media Geek Dude and no one then invites me to parties.

I don't care about their stupid parties. I have fun with Mr. Skittles and my new tea set.
posted by Lipstick Thespian at 3:51 PM on January 15 [7 favorites has favorites]


I need to rewatch Primer to see if theres some way in which it ties up neatly, as towards the end it seemed to get a bit fuzzy in a time-wimey way - that could just me not paying enough attention though.
posted by Artw at 3:56 PM on January 15


I *tried* to watch Stalker. I really did. And it made me wish I had been watching something a bit more fast paced and engaging... like maybe paint drying. When I got to the point that I realized that I desperately wanted to punch Tarkovsky in the face, I gave in and stopped about 3/4 of the way through.

Truth to tell, Solaris didn't grip me too well either. I understand that Tarkovsky is revered by a lot of people whose opinions I respect, but I just don't get his stuff. My brow is just too low, I guess.
posted by John Smallberries at 3:57 PM on January 15


Wot no Dark Star?
posted by ijoshua at 4:00 PM on January 15 [5 favorites has favorites]


Yeah, as far as considering #10 goes, I made it halfway through the second sentence.

The Rotten Tomatoes list has the Tarkovsky film Solaris, but I’ve chosen Stalker. This is a slower-paced movie
posted by Durn Bronzefist at 4:01 PM on January 15


Heh. I actually rate the Clooney one higher, on the grounds that I can actually watch it from start to finish. And, though people complain about the translation, I’m still a big fan of the book (which, you’ll be pleased to hear, is a reasonable length).
posted by Artw at 4:01 PM on January 15


It's missing Sins of the Fleshipoids (pt 1, pt 2).
posted by Lentrohamsanin at 4:12 PM on January 15


There's a relevant AskMe thread from last summer: What science fiction films are there, iyho, that really measure up to the best of written work in that genre?

Some really good recommendations there.
posted by mediareport at 4:14 PM on January 15 [3 favorites has favorites]


How could anyone not have seen Gattaca? They show it in schools, for fucks sake. I saw it twice in school, once in middle school and again in high school.
I feel kind of weird, hanging around in schools just to catch the movies. Hell, I haven't been inside a high school in 20 years!
posted by nowonmai at 4:21 PM on January 15 [2 favorites has favorites]


Soylent Green has a lot to think about. So does Forbidden Planet.

GATTACA would have been so much better with real casting - Ethan Hawke can't act his way out of a paper bag. I also had a lot of problems with its basic plot points. Sorry, you can't get people to daily take a blood draw pin prick for no medical reason - ask diabetics how it feels - and you can't scrub yourself free of leaving bits of DNA all over the place no matter how hard you try. Plus, as the whizzinator has taught us, a fake penis or tube to pee into a testing cup just isn't going to cut it - not in my interplanetary future, anyway.

The Matrix also loses major points as a "thinking" movie as the plot is a disaster on many levels. You forgive it as an action flick, and as an action flick it is one of my favorites.

Dune could have been on this list if made closer to the book. So could pretty much any H.G. Wells story as his Sci-Fi is built to make you think. Hell, even Starship Troopers has a lot of social commentary.

So, sorry, I have to say these lists are arbitrary...like that's shocking news, I know.
posted by Muddler at 4:32 PM on January 15


"Silent Running", anyone?

Saw it for the first time last year and will warn anyone looking for "thinking" scifi far away from that one, or at least to drastically lower your expectations. What a clunker, with a dumb plot that doesn't even make sense on its own terms. Ok, you're a nature-loving loner, so what's the first thing you do after all the other people are gone? You reprogram the robots so they act more human and play cards with them. Yeah, that makes sense. Anyway, the acting is terrible and the pace far too slow. I can see why folks liked it when it first came out, and why folks who saw it as kids might have a pleasant attachment to its hokey badness, but in a thread about "thinking person's scifi"? No way.
posted by mediareport at 4:38 PM on January 15



How could anyone not have seen Gattaca? They show it in schools, for fucks sake. I saw it twice in school, once in middle school and again in high school.

That is all the more reason for me to put off seeing Gattaca indefinitely. And not just because the otherwise lovable and normal-seeming coach who taught my soccer class had it planned out, I swear to god, that we would watch Faces of Death if we behaved. (I can't remember if we misbehaved too much or someone's parent intervened, but it never happened, thank god.) All I can think of for the "movies teachers make you watch in class" category is Field of Dreams, which brings its own horror, of schmaltz endlessly repeated.


We had Channel One back in my day, anyway. Couldn't wait for those Skittles commercials.
posted by theefixedstars at 4:40 PM on January 15


Creation Of The Humanoids? More like Metafilter mod meetup amirite?
posted by turgid dahlia at 4:45 PM on January 15


Am I the only person who enjoyed Primer, owns it, loves anything related to time-travel science fiction or cleverly abstracted storytelling, loves ingenuity driven low budget filmmaking... but still kind of thinks Primer is just a little over hyped?
posted by SmileyChewtrain at 4:45 PM on January 15 [2 favorites has favorites]


Id love to see someone re-edit, if not, remake Primer. Its really just a 30 minute Twilight Zone episode stretched out to 90 minutes; and its a lot looong 90 minutes. The first half hour is just a lot of tech mumbo jumbo about what the primer really is. After 30 or so minutes they just tell you.

Id also argue that a movie about a man with miraculous powers isnt sci-fi, its fantasy.

No Existenz, Brazil, Dune, Rollerball, Max Headroom (seriously), or Cube? That said, its a very interesting list and I will be checking out some of these movies.
posted by damn dirty ape at 5:03 PM on January 15 [1 favorite has favorites]


I think Contact is a pretty great sci fi movie a bit heavy handed but genuinely wondrous. I also like Haneke's Le Temp du Loup (Time of the Wolf), it's a fantastic post apocalyptic film and by fantastic I mean a harrowing, solitary death march that will suck you dry of human feeling.
posted by doobiedoo at 5:11 PM on January 15


Can anyone personally recommend it?(Stalker)

Yes, yes, yes. It is a very slow paced film, but well worth it, IMO. Very haunting in concepts and images- I was turning it over in my mind for days after seeing it.
posted by Dr-Baa at 5:26 PM on January 15


I don't know, I've been a big fan of The Man Who Fell to Earth for a long time...is this where I say, "Hey, why isn't a Bowie movie on the list?"
posted by Chuffy at 5:36 PM on January 15


I think the most value I got from this post is that I finally found the name of the worst movie I've ever seen: Stalker.
posted by Osmanthus at 5:40 PM on January 15


"There aren’t really any special effects and the movie is almost entirely robots and humans conversing with each other."

Sounds more like 'My Dinner with Android'.
posted by Kronos_to_Earth at 5:42 PM on January 15 [5 favorites has favorites]


Videodrome would be near the top of my own personal sci-fi list.
posted by SmileyChewtrain at 5:45 PM on January 15 [2 favorites has favorites]


Though I guess that would be more like "tech-fi."
posted by SmileyChewtrain at 5:46 PM on January 15


A diagram of Primer's timeline(s). Spoiler, I guess, as long as you're brilliant enough to comprehend the monstrosity at first glance.
posted by Rhaomi at 6:03 PM on January 15 [4 favorites has favorites]


Also, the full film is on Google Video.
posted by Rhaomi at 6:05 PM on January 15 [3 favorites has favorites]


No Incredible Shrinking Man? How could one overlook a meditation of on the meaning of identity and humanity. And a giant spider!
posted by SPrintF at 6:09 PM on January 15


I understand that Tarkovsky is revered by a lot of people whose opinions I respect, but I just don't get his stuff. My brow is just too low, I guess.

You're not alone. I find Tarkovsky to be unwatchable, and liked the Clooney Solaris almost as much as the book. Not a thing made, eh?
posted by Ritchie at 6:12 PM on January 15


Although I seem to remember enjoying The Fly with some gusto when it was initially released, even then its bad science irked and flags it as an absolute non-contender for a list like this. Specifically, it bugged (pun? who knows/cares) me that Goldblum's magic portaloos managed to combine the DNA or whatever-the-hell of a human and an insect, yet somehow managed to avoid scrambling the DNA of all the millions of other organisms living within both of them. Secondly, Goldblum's character had clearly also managed (as some kind of mere Sunday hobbyist activity) to knock the Turing test into a cocked hat with his bloody sentient computer. I hated that and it vaguely bothers me now, 22 years later, for reasons too depressing to consider.

I'd also add Seconds to this list and the almost forgotten The Terminal Man: sure, it was Crichton and all that but Hodges gave it a certain class.
posted by specialbrew at 6:25 PM on January 15


I think my list would have included Brazil. Yeah, definitely Brazil. Probably THX-1138, Solaris, La Jetee, and ... uhm ... yeah Zardoz. I mean, in no way is Zardoz a good movie -- it's laughable at every possible turn -- but there's quite a bit to it that is rarely noticed on the second or third (or thirteenth, fourteenth) viewing.

No! I will not go to second level with you!

My list would not, however, include Logan's Run. Though there's a part of me that wants it to. It's the same part that wants to be a crazy old man living in the Capitol Building with a bunch of cats.
posted by The Great Big Mulp at 6:27 PM on January 15 [3 favorites has favorites]


Rhaomi, thank you. It doesn't actually help, mind you, but that's neither your fault nor the diagram's. I've seen that movie... three times now, I think... and it's still a tough nut to crack.
posted by wastelands at 6:28 PM on January 15


Am I the only person who enjoyed Primer, owns it, loves anything related to time-travel science fiction or cleverly abstracted storytelling, loves ingenuity driven low budget filmmaking... but still kind of thinks Primer is just a little over hyped?

Ah! You must be the other guy at the meetings!
posted by ricochet biscuit at 6:33 PM on January 15


Saw [Silent Running] for the first time last year and will warn anyone looking for "thinking" scifi far away from that one, or at least to drastically lower your expectations.

Yah, it's dumb on a whole host of levels.

First, even if the environment on Earth has gone totally to shit, there's no reason to send the forest modules into space. Just put them somewhere out of the way on Earth.

Then, even if they did for some reason put the forest modules in the orbit of Saturn for no obvious reason, and then decided to return the freighters to commercial service, there's absolutely no reason why they would nuke them. Just leave them alone, let them float along with beacons. Hell, there are good, practical reasons not to nuke them -- highly refined uranium or plutonium is aspensive.

And, as you note, Bruce Dern's character doesn't make a lot of sense.

And jee-zus fuck, the singing. It's an open-a-vein awful parody of itself. It's even more a parody of warbly squishy hippy folk tunes than "Listen to the Flower People" is.
posted by ROU_Xenophobe at 6:59 PM on January 15


I'll submit The Quiet Earth. Even though I really don't remember it very well. Something about a Tesla wireless world-wide power grid that went terribly wrong.

I'll also second The Man Who Fell to Earth. The idea of alien technology disrupting the economy so much that they track him down to stop it is pretty interesting. Plus, of course, it was the role Bowie was created to play...
posted by Bron at 7:02 PM on January 15 [1 favorite has favorites]


And I'll second or third that if you can get past the hippy-dippy 70s goofiness of Zardoz, and past Seannery in his leather underoos, there's a decent movie in there about the different inhabitants of a post-Singularity world, sort of.
posted by ROU_Xenophobe at 7:05 PM on January 15 [1 favorite has favorites]


Yeah, for all its cringe-inducing moments - and it has more than a few, for sure - Zardoz is still definitely worth watching. And while I'm here, I'll repeat my recommendations in that AskMe from last summer (none of which have been mentioned here, surprisingly enough): the ridiculously under-rated Sunshine, the gorgeously abstract and fascinating The Fountain, and the oddball freakazoid lunatic gem The American Astronaut.

All three should be on any list of "non-obvious thinking person's scifi."
posted by mediareport at 7:40 PM on January 15 [2 favorites has favorites]


Metropolis! The recent DVD version also has a Giorgio Moroder score.
posted by so much modern time at 7:50 PM on January 15 [1 favorite has favorites]


I gotta nominate Phase IV, THX-1138, and Fantastic Planet.
posted by schoolgirl report at 8:11 PM on January 15


Boo, I don't think I could be friends with someone who doesn't like Sleeper.

Adding Primer to my Netflix queue, though.
posted by naoko at 8:35 PM on January 15 [1 favorite has favorites]


"Wot no Dark Star?"
How do you know that exists as an actual movie and not a hallucination of yours?

Primer is outstanding.
I've got to go with damn dirty ape on some of those picks - especially Brazil, Rollerball and Cube.
And specialbrew on why The Fly shouldn't be there.
And The Quiet Earth belongs at the top of the 'thinking' list.
THX-1138 - before Lucas butchered it, yeah. I think I heard a Jawa "Utani!" in the last chase sequence.
I'd add the B movies Nemesis (if you chop off the goofy bits near the end) for the whole cyberpunk question of 'am I still human?" (Won't make any difference you no care brudda), and The Blood of Heroes for 'just what constitutes society anyway?'
I liked Strange Days, just missed it by a little though.
posted by Smedleyman at 9:10 PM on January 15


I usually don't care for top ten lists, but.. I have never heard of Creation of the Humanoids, and I thought I knew my obscure sf movies pretty well. So Yay. Also, thanks mediareport - I just watched a youtube clip of The American Astronaut and, uh, wow.
posted by gamera at 9:16 PM on January 15


Forbidden Planet is on neither list nor in that thread. Shame on you all.

(or shame on me)
posted by wobh at 9:24 PM on January 15


No Fountain?!

ICALLSHENANIGANS

I'm completely unreasonable when it comes to my love of The Fountain.

Stalker is a joy, though. For some reason it, and Arkady and Boris Strugatsky's Roadside Picnic, the novel the film is based on, have come up in conversation a lot lately. Maybe I need to read the book and watch the film again.
posted by Kattullus at 9:24 PM on January 15


/unleashes monsters from the id at wobh.
posted by Artw at 9:31 PM on January 15


You know what would be strangely awesome? An adaptation of the novel version of Solaris by Jack Kirby.
posted by Artw at 9:33 PM on January 15


Hah! Rhaomi, after I saw that movie I searched for explanation and found that exact pic. I love that movie, but it is confusing as hell.
posted by graventy at 9:38 PM on January 15


It seems to me that "Silent Running" broaches the issue of eco-terrorism in a pretty compelling way. But I may be in the wrong tavern here. I couldn't sit through "Primer".
posted by No Robots at 9:39 PM on January 15


I was really surprised by Zardoz, after considering it a baffling joke for many years. It's a very interesting film - and starring a Charlotte Rampling in her prime, which I, as a Thinking Man, certainly enjoyed.
- posted by Auden at 5:47 PM on January 15



This is SUCH a straight line that I'm obligated to finish the joke:

"And what do you think of Rampling?"
...to which the punchline is...

"I don't know, I've never Rampled."



(And yes, I'm another fan of Zardoz. It does everything that a good sf movie is supposed to do. But with Connery in a loincloth.)
posted by AsYouKnow Bob at 9:53 PM on January 15


Primer?! Great idea, poor implementation. Questionable. I personally didn't like the movie at all (but it did make me think a little).

A Boy and His Dog? Heh, it's a favourite, ableit a guilty favourite. Anyone who likes this movie who owns a PC or a mac capable of running old PC programs should play the original Fallout and Fallout 2 games. Fallout 3 isn't Fallout 3 (as in, a sequel to the orignal and 2). Fun game, crap ending, but not really a sequel to the original Fallouts.

I agree with devil's rancher on Bladerunner, but then you'd have to mention Total Recall. No, seriously.

GATTACA - meh. Could be done much better. Still, decently cautionary. Done much more so better (different caution, though) with Handsmaid's Tale. GATTACA relied too much on Star Trekish shortcuts which don't hold up to (rapidly?) advancing 'actual' scientific/engineering techniques.

Stalker; interesting - I wonder how much that film influenced S.T.A.L.K.E.R.?
posted by porpoise at 10:01 PM on January 15


#1 reminded me of Ghost in the Shell, which I would put on that list.
posted by alexei at 10:09 PM on January 15


There are some very good sci-fi anime movies. alexei mention Ghost in the Shell, that's a good one. I also recommend Memories (three very stylized sci-fi stories, it's like the filmic equivalent of a short story collection) and Paprika (about the effects of a new invention that lets people enter other peoples' dreams) Paprika leans pretty far towards fantasy at some points though.
posted by One Second Before Awakening at 10:34 PM on January 15


"Top 10 Science Fiction Flicks For The Thinking Man (beerandscifi version)"

Impossible. Beer is antithetical to thought.

'"Silent Running", anyone? And Joan Baez sings the theme song.'

I thought that was Mike + The Mechanics.

An interesting bit I noticed last night at the beginning of Bill & Ted's Excellent Adventure. As Rufus is talking about the ways in which the future is better, he mentions "bowling averages are up, minigolf stores are down." He then goes on to mention that of all the planets we are in communication with, our waterslides are the most excellent. Not, "planets we have traveled to." Planets we are in communication with. It's a subtle but impressive touch. Of course, the fact that they can travel in time (but not in space, not faster than the speed of light anyway) presents a bit of a head-scratcher.
posted by Eideteker at 11:54 PM on January 15 [1 favorite has favorites]


I've always thought GATTACA to be an excellent film, and it's nice to see it show up on both of the lists. It totally blew me away the first time I saw it.
posted by tehloki at 12:54 AM on January 16 [1 favorite has favorites]


Gattaca? what the hell? not worthy of top10.

Another Zardoz supported here. watched it the other day and its is still awesome (and deep).

also can't believe Dark Star is not on there as it practically defines 'Thinking mans SciFi"

I just watched 'The Quiet Earth' two weeks ago - and its ok but not top 10. Threads, or even 'The Day After' are better post apocalypse films.
posted by mary8nne at 2:28 AM on January 16


Am I the only person who enjoyed Primer, owns it, loves anything related to time-travel science fiction or cleverly abstracted storytelling, loves ingenuity driven low budget filmmaking... but still kind of thinks Primer is just a little over hyped?

I think Primer is a lot overhyped, actually...but I may have been in a pretty bad frame of mind when I saw it, and maybe I would like it a little better now? Because what I remember is getting a preview pass that said "'Best science fiction film since 2001' - Some Pretentious Media Outlet, Don't Ask Me Which One," and what I got was what looked like the cast of Office Space standing around in somebody's garage. That said, I think the moody early part of the movie is pretty good; it's about halfway through, when the sf elements kick in, that it kinda loses me. Because yeah, it basically becomes the lowest-budget "Outer Limits" of all time, and I was sort of hoping for something a little fresher than your basic SPOILER SPOILER story. Had they made the same movie for ten million dollars, I don't think it would be looked upon as fondly, to be really honest...I think it's one of those Clerks/Blair Witch situations where people are just so impressed that it was made that it gets some extra brownie points.
posted by kittens for breakfast at 4:14 AM on January 16


I'd have to say that Sunshine gets a big Fail from me because a) in the future, all scientists have fallen out of a Diesel catalogue and b) if you realise, in the first minute or so, that the entire enterprise (driving a bomb into the Sun) could be entirely automated, all interest in the proceedings ends right there.
posted by specialbrew at 5:00 AM on January 16


Okay, specialbrew, I've had training for just this situation (the science majors would divide into teams at the beginning of episodes of ST:TNG, one team would argue against the science in the show, the other team arguing for it; today I will be in the team arguing for the science):

The computer running the telepods in The Fly had a lower limit set for mass, perhaps a size limit as well; otherwise, you'd have a telepod that would be shuttling air around as well. My guess is that the size limit would be one of the first things Brundle would consider. He'd be deciding what he'd use for an upper limit and, methodical as he is, he'd pick a lower size limit right afterwards. The machine wouldn't function if there was nothing large enough to analyze, or too large to fit or otherwise come up against resource limitations.

Later on, though, after he teaches the computer to be made crazy by the flesh, he probably considers the issues of parasites, symbiosis, and so forth. Screen those out when dealing with the recreation of the large-scale organism. Consider only the DNA of the largest portion of the object in rebuilding. There's probably a copy operation for unicellular organisms, which are already telepod-safe. Remember, the baboon didn't come out as complete salad, it still had individual cells, they simply weren't all in the right place. The DNA and the poetry of the steak were necessary for analyzing relationships between cells, not in the cells. Brundlefly didn't come down with wrenching gastrointestinal distress right afterwards, so we know the computer grabbed the gut bacteria along with Brundle himself.

Brundle's mistake is simply in thinking that he'd have only one object in the telepod at a time. And the computer does the sort of things computers do when faced with surprises, it surprised him back. It decides to cat two files together. This might not be a problem, except that it decided that the cat operation should happen somewhere around the DNA analysis, and thus Brundlefly was born.

And he hasn't made it pass the Turing test. He probably didn't even write most of it, as he admits that he farms out technology to "men more brilliant than I." His computer is "simply" a natural language processor (with voice recognition) and about as much sense as prolog, that is, it's goal-directed and can work within a framework of rules, but won't think outside of the box. It's passive, it does what it is told, but it certainly doesn't have desires of its own or any consciousness. Aside from its obviously-unintelligent creation of Brundlefly, I submit that final message, "FUSION OF BRUNDLEFLY AND TELEPOD SUCCESSFUL," as the kind of logically stupid and consistent thing you'd expect from a computer without a lick of sense. No posthumous Turing prize for Dr. Seth Brundle.

I still use that as an debugging message when final sanity checks fail in very large programs I write, by the way. That and, "That'll put marzipan in your pie plate, Bingo!"
posted by adipocere at 5:09 AM on January 16 [3 favorites has favorites]


I had to watch Stalker in fast-forward. It was still a little slow.
posted by starman at 5:15 AM on January 16


No Brother From Another Planet? Feh.
posted by grubi at 6:17 AM on January 16 [1 favorite has favorites]


Time Bandits?
posted by grubi at 6:21 AM on January 16 [1 favorite has favorites]


I saw Primer on the Sundance Channel or something similar when I was channel-surfing one night before bed -- was just planning to stay up another half hour, but this completely sucked me in -- the very mundanity and ordinariness of it was what drew me. For me, the more effects a movie has the less likely I am to believe it; it just makes it easier to dismiss as "okay, that's CGI/foley/bluescreen/etc." because life does not come with a John Williams score. The very fact that Primer looks so ordinary gives it the feel that someone really did follow these two guys around and film what actually happened, and that's where I get pulled in.
posted by EmpressCallipygos at 6:22 AM on January 16


Solaris is an interesting case. I liked the book very much when I read it decades ago. I saw the Soderbergh film a couple of years back and enjoyed it but it didn't really have the flavor of the book. Then I saw the Russian film. Tartovsky nailed the flavor of the Lem novel, but the surface glitz of the Soderbergh film (and its faster pace, yes) is more appealing to a post-Star Wars audience. I have concluded that this is one case where it is helpful, in terms of discussion, to be exposed to all three versions.

I wish someone would film His Master's Voice but I ain't holding my breath. Closest thing to it that I can think of was the British telefilm, A for Andromeda, which wasn't based on Lem's work, but was written by cosmologist Fred Hoyle (who coined the term "Big Bang" but didn't believe in that theory).
posted by Guy_Inamonkeysuit at 6:53 AM on January 16


Plus, as the whizzinator has taught us, a fake penis or tube to pee into a testing cup just isn't going to cut it - not in my interplanetary future, anyway.

I think you need to watch GATTACA again as you missed the exchange between Ethan Hawke's character and the person administering the urine test in the last scene.
posted by euphorb at 7:20 AM on January 16


The Day the Earth Stood Still, original version, would be on my arbitrary list.
posted by asok at 7:41 AM on January 16


I still haven't seen the Tarkovsky version of Solaris, but I enjoyed the Soderbergh version and the original novel quite a bit. Don't know how well HMV would fare film-wise, but it's one of my favorite books and I'd damn sure see a movie version unless it was somehow Bruckheimer'd & Bay'd (which is easy, if painful, to visualize).

utsutsu, if you're still following this, Roadside Picnic (full-text PDF) -- the novella on which Stalker is based -- is one of the most crushing and fantastic books I've ever read. I'm really not too hot on Stalker, itself.

OK, so Tarkovsky's Solaris and a re-read of Roadside Picnic. My weekend's set. Thanks ArtW.
posted by cog_nate at 7:49 AM on January 16


Sunshine was pretty good fi but not very good sci. It goes pretty well with The Fountain, if you're in the mood for "coming to grips with man's mortality" films.
posted by Eideteker at 8:03 AM on January 16


Guy_Inamonkeysuit - I really liked His Master's Voice, but I’m not sure it should ever be filmed though – nothing much happens that’s inherently filmic, and if they tried to liven it up it’d start like the gathering of the team from the Andromeda Strain end up turning into Contact or Species or something – the end result being a horrible point-missing mess.
posted by Artw at 9:45 AM on January 16


...or what cog_nate said...
posted by Artw at 9:46 AM on January 16


I know, ArtW; I live in a fool's paradise. Of course, I like Andromeda Strain and Contact, so...

And I agree that it's odd not to find Forbidden Planet or the original The Day The Earth Stood Still or even Bride of Frankenstein on that list. As opposed to Creation of the Humanoids? Come on, now. Hell, even The Terminator gives you something to think about, and functions pretty well as a love story.
posted by Guy_Inamonkeysuit at 12:48 PM on January 16


Oh shit! Invaders From Mars (and not the Tobe Hooper remake, please.) Fucking brilliant little low budget movie that realy scared the pants off me as a kid. It shares a basic theme with I Married A Monster From Outer Space (don't laugh) -- no one believes the protagonist about what is happening. In Invaders it's because he's just a kid... in Married it's because she's a woman.


And of course the original Invasion of the Body Snatchers.
posted by Guy_Inamonkeysuit at 12:59 PM on January 16


Le Voyage dans la lune, 1902. Special effects, action and comedy from 107 years ago.
posted by Harry at 3:27 PM on January 16


Oh, and I'd like to point out Kin dza dza. Maybe not a Top 10 movie, but certainly an entertaining piece of Russian (cult) scifi. It has a kind of Hitchhiker-y feel to it.
posted by Harry at 3:39 PM on January 16


To all the new people, this post is for you. I want to say hello and welcome to the blog and now I’ll tell you a little about what happens here.
posted by Artw at 3:31 PM on January 17


Coincidentally, Sunshine was on its way to me from Netflix when this post came up, and I watched it last night. I found the most thought-provoking moments came at the very end, when I was thinking, “wait… what?” (Though, I did appreciate the throwback to Dark Star in having the insane captain named Pinbacker.)
posted by ijoshua at 4:05 PM on January 17


adipocere: ...after he teaches the computer to be made crazy by the flesh, he probably considers...

Ahhh, but it's that probably that is so troubling. The fly and Brundle are discrete objects and are scrambled: on a cellular level, I'm not sure precisely how (based purely on mass, or even cellular relationship) his machine could determine what precisely is a singular organism or the superorganism a human being almost certainly is. To work, any kind of teleportation would have to rely on spacial rather than cellular mapping, so that the contents of one pod (including its air) are swapped as a precise array of 3D molecular and space data. In this way, the fly would also be transported but simply arrive at absolutely the same proximity away from Brundle as it was sent.

Sadly, I don't have a copy of The Fly on hand to review its circa 1986 computing firepower, but I seem to recall being incredibly irritated by its pull n' reveal of a nicely-rendered housefly, which presumably it sucked out of the (pretty much) pre-net ether. To be honest, I always took Brundle's this-was-all-put-together-by-guys-much-smarter-than-me line as a bit of false modesty, strategically employed for the purpose of courtship.
posted by specialbrew at 4:13 PM on January 17


I found the most thought-provoking moments came at the very end, when I was thinking, “wait… what?”

Are you talking about when the hero and his girl fell down the side of that massive cube, and stuck to the middle of the face they were falling down? I took it to mean the cube was extremely dense, which made sense considering it represented "all of the Earth's remaining fissile material." I realize it would not be dense enough to have what appears to be a full G of gravity, but I found that concept pretty cool as presented anyhow.
posted by autodidact at 8:27 AM on January 19


Sadly, I don't have a copy of The Fly on hand to review its circa 1986 computing firepower, but I seem to recall being incredibly irritated by its pull n' reveal of a nicely-rendered housefly, which presumably it sucked out of the (pretty much) pre-net ether.

Dude, do not be hating on the BBS era.
posted by Artw at 8:56 AM on January 19


« Older "Authored by the U.S. Joint Forces Command (U...   |   US Airways Flight 1549 has cra... Newer »


This thread has been archived and is closed to new comments