Tweeeeets in Spaaaaace.......
August 12, 2009 7:37 AM Subscribe
While we may be tuning in, Earthlings haven’t done much to deliberately broadcast messages to space (unless you count the Voyager gold record). Now you can send a 160 character message towards Gliese 581d, the nearest known earth-like planet.
@X_Gliese581d_X Change your location to Tehran
posted by infinitewindow at 7:45 AM on August 12, 2009 [5 favorites]
posted by infinitewindow at 7:45 AM on August 12, 2009 [5 favorites]
Earthlings haven’t done much to deliberately broadcast messages to space (unless you count the Voyager gold record)
Also including the Arecibo message.
posted by RobotVoodooPower at 7:51 AM on August 12, 2009
Also including the Arecibo message.
posted by RobotVoodooPower at 7:51 AM on August 12, 2009
Many of these make me twitch, while others of them - usually the ones from Italy, which seems to have a large '8D UNIVERSE IS AWESOME WE LOVE YOU' quotient - make me quite happy.
It's very neat to see people trying to convey abstract stuff like mathematics or emotion in 160 characters in different ways, though. The '1 = 1', '11 = 2', '111 = 3' stuff seems like a good way to start off from a visually recognizable truth, though I suppose it does sort of rely on their equals sign being, well, an equals sign.
posted by stelas at 7:55 AM on August 12, 2009
It's very neat to see people trying to convey abstract stuff like mathematics or emotion in 160 characters in different ways, though. The '1 = 1', '11 = 2', '111 = 3' stuff seems like a good way to start off from a visually recognizable truth, though I suppose it does sort of rely on their equals sign being, well, an equals sign.
posted by stelas at 7:55 AM on August 12, 2009
The message are all in English.
I was going to link to an awesome alien communication resource, but I cannot for the life of me find it. It was a series of images that encoded the decimal numbering system, some mathematics, physics, chemistry, etc all into something aliens might be able to decode. It was a fun game trying to decode it yourself.
posted by DU at 7:57 AM on August 12, 2009
I was going to link to an awesome alien communication resource, but I cannot for the life of me find it. It was a series of images that encoded the decimal numbering system, some mathematics, physics, chemistry, etc all into something aliens might be able to decode. It was a fun game trying to decode it yourself.
posted by DU at 7:57 AM on August 12, 2009
So of all the wondrous things humanity has achieved, of all the eloquence and beauty we have created, Twitter is going to be our first contact?
We're dead.
posted by nosila at 8:00 AM on August 12, 2009 [3 favorites]
We're dead.
posted by nosila at 8:00 AM on August 12, 2009 [3 favorites]
I'm too busy keeping up on Spacebook.
posted by FelliniBlank at 8:07 AM on August 12, 2009 [2 favorites]
posted by FelliniBlank at 8:07 AM on August 12, 2009 [2 favorites]
RT @Gliese_581d twitter is too full of spam. Got flooded today. What happened >> I'm with u bro.
posted by allen.spaulding at 8:16 AM on August 12, 2009
posted by allen.spaulding at 8:16 AM on August 12, 2009
YOU WERE SUPPOSED TO PICK ME UP LIKE 10 YEARS AGO. WTF?
posted by The Whelk at 8:17 AM on August 12, 2009 [3 favorites]
posted by The Whelk at 8:17 AM on August 12, 2009 [3 favorites]
The '1 = 1', '11 = 2', '111 = 3' stuff seems like a good way to start off from a visually recognizable truth, though I suppose it does sort of rely on their equals sign being, well, an equals sign.
Not really. With enough info, they could deduce it from context.
posted by DU at 8:17 AM on August 12, 2009
Not really. With enough info, they could deduce it from context.
posted by DU at 8:17 AM on August 12, 2009
Twitters in space
Twitters in spa-a-hace
Whatcha doin' out there man?
That's pretty freaky, Twitter
I hear that space is a pretty freaky place.
Isn't it cold out in the Depths of space, Twitter?
Does the space cold make your failwhale go all pointy?
And do you use your pointy whale as telescopic antennae
Transmitting data back to Earth?
(Data back to Earth, Data back to Earth)
posted by filthy light thief at 8:22 AM on August 12, 2009
Twitters in spa-a-hace
Whatcha doin' out there man?
That's pretty freaky, Twitter
I hear that space is a pretty freaky place.
Isn't it cold out in the Depths of space, Twitter?
Does the space cold make your failwhale go all pointy?
And do you use your pointy whale as telescopic antennae
Transmitting data back to Earth?
(Data back to Earth, Data back to Earth)
posted by filthy light thief at 8:22 AM on August 12, 2009
I get a little bit edgy and perturbed whenever I see something like this, but then I'm comforted by the fact that anyone who does intercept these messages won't be able to understand a word of them.
I wonder if all the time we spend listening for carefully crafted messages would be better spent working out what's Intergalactic for HOW IS BABBY FORMED LOL THX.
posted by lucidium at 8:22 AM on August 12, 2009
I wonder if all the time we spend listening for carefully crafted messages would be better spent working out what's Intergalactic for HOW IS BABBY FORMED LOL THX.
posted by lucidium at 8:22 AM on August 12, 2009
Okay, my actual message
.. ... ..... ....... ........... ............. ................. ................... ....................... .............................
I know, original.
posted by The Whelk at 8:23 AM on August 12, 2009 [2 favorites]
.. ... ..... ....... ........... ............. ................. ................... ....................... .............................
I know, original.
posted by The Whelk at 8:23 AM on August 12, 2009 [2 favorites]
Anticryptography is the term for this type of message.
I once spent a (not even slightly chemically altered) night with a friend working on the best way to do this. Then in the morning we separately found out about this field of research.
posted by Lemurrhea at 8:23 AM on August 12, 2009 [1 favorite]
I once spent a (not even slightly chemically altered) night with a friend working on the best way to do this. Then in the morning we separately found out about this field of research.
posted by Lemurrhea at 8:23 AM on August 12, 2009 [1 favorite]
Gliese 581d to Earth: Please Unsubscribe
posted by Pollomacho at 8:25 AM on August 12, 2009 [16 favorites]
posted by Pollomacho at 8:25 AM on August 12, 2009 [16 favorites]
DU, was this series of images by Y. Dutil and S. Dumas the message you were thinking of?
posted by lucidium at 8:30 AM on August 12, 2009 [1 favorite]
posted by lucidium at 8:30 AM on August 12, 2009 [1 favorite]
Not really. With enough info, they could deduce it from context.
Fair point. There's also more obscure ones, including )) (( | for echo, which I thought was quite neat.
posted by stelas at 8:31 AM on August 12, 2009
Fair point. There's also more obscure ones, including )) (( | for echo, which I thought was quite neat.
posted by stelas at 8:31 AM on August 12, 2009
BRING BEER
posted by BitterOldPunk at 8:33 AM on August 12, 2009 [2 favorites]
posted by BitterOldPunk at 8:33 AM on August 12, 2009 [2 favorites]
My weekday job doesn't require much (if any) active brainwork so my mind often travels down various odd pathways. The other day, for some reason, I was thinking about how bizarrely strange it would be if we somehow beamed the internet out into space and all of that information was received by a species billions of light years away. That far-off species may have to devote a lot of time and resources to decoding and deciphering all of this information, perhaps with full generations working their entire lives just to make a single breakthrough then dying before they got to see anything substantive come of their work. And then, finally, when the code gets cracked and all of the time they devoted comes to fruition, the very first thing they see is Tubgirl.
So, I'm kind of intrigued by this. On the other hand, I really can't wait for the fucking economy to pick back up.
posted by Ufez Jones at 8:33 AM on August 12, 2009 [1 favorite]
So, I'm kind of intrigued by this. On the other hand, I really can't wait for the fucking economy to pick back up.
posted by Ufez Jones at 8:33 AM on August 12, 2009 [1 favorite]
/When I take you out in space with me
Oh honey baby what a sight you'll see
We will travel to the sea of Gilese
In the slickest ship you've ever seen./
posted by The Whelk at 8:36 AM on August 12, 2009
Oh honey baby what a sight you'll see
We will travel to the sea of Gilese
In the slickest ship you've ever seen./
posted by The Whelk at 8:36 AM on August 12, 2009
And then, finally, when the code gets cracked and all of the time they devoted comes to fruition, the very first thing they see is Tubgirl.
Thanks, I needed that laugh. The buildup was good, and the payoff is coffee on my desk.
posted by Pragmatica at 8:36 AM on August 12, 2009
Thanks, I needed that laugh. The buildup was good, and the payoff is coffee on my desk.
posted by Pragmatica at 8:36 AM on August 12, 2009
I sent an SQL injection hack. That's what Gliese 581d gets for running phpBB.
posted by Pastabagel at 8:38 AM on August 12, 2009 [3 favorites]
posted by Pastabagel at 8:38 AM on August 12, 2009 [3 favorites]
Frankly, I wish they weren't doing this - active SETI's potential dangers aren't worth it. Seed has a good overview of the arguments.
If we haven't heard from other civilizations, maybe there's a reason why.
posted by dragoon at 8:44 AM on August 12, 2009
If we haven't heard from other civilizations, maybe there's a reason why.
posted by dragoon at 8:44 AM on August 12, 2009
YOU GUYS WANT MORE CHUCK BERRY? BY THE WAY, FRANK DRAKE WANTS TO SPEAK TO YOU.
posted by Guy_Inamonkeysuit at 8:50 AM on August 12, 2009
posted by Guy_Inamonkeysuit at 8:50 AM on August 12, 2009
If we haven't heard from other civilizations, maybe there's a reason why.
I want to die as I lived. In a massive interplanetary war.
posted by The Whelk at 8:53 AM on August 12, 2009 [2 favorites]
I want to die as I lived. In a massive interplanetary war.
posted by The Whelk at 8:53 AM on August 12, 2009 [2 favorites]
DU, was this series of images by Y. Dutil and S. Dumas the message you were thinking of?
Yes! So excellent. I got a couple pages (or all the way?) into it once. It's pretty fun.
posted by DU at 8:53 AM on August 12, 2009
Yes! So excellent. I got a couple pages (or all the way?) into it once. It's pretty fun.
posted by DU at 8:53 AM on August 12, 2009
GLIESAN CENTRAL COMMAND, FROBNAX 42, 9883:
Gliesan Scientist: "We still haven't decoded the transmissions, Supreme Overlord. We've got most of it, and it seems mostly benign, but we're having trouble with a few phrases... lulz? Goatse? Fags? What could it mean?"
Gliesan Supreme Overlord: "WE CANNOT TAKE THE CHANCE. READY THE ATTACK FLEETS. BRING THE DEATH RAY ONLINE. WE LEAVE IMMEDIATELY!"
posted by DecemberBoy at 8:58 AM on August 12, 2009 [1 favorite]
Gliesan Scientist: "We still haven't decoded the transmissions, Supreme Overlord. We've got most of it, and it seems mostly benign, but we're having trouble with a few phrases... lulz? Goatse? Fags? What could it mean?"
Gliesan Supreme Overlord: "WE CANNOT TAKE THE CHANCE. READY THE ATTACK FLEETS. BRING THE DEATH RAY ONLINE. WE LEAVE IMMEDIATELY!"
posted by DecemberBoy at 8:58 AM on August 12, 2009 [1 favorite]
"Happy birthday, you thing from another world, you!"
posted by Guy_Inamonkeysuit at 9:00 AM on August 12, 2009
posted by Guy_Inamonkeysuit at 9:00 AM on August 12, 2009
Please stay away. Humans beings are life malformed. You do not want to know us. We are malignant and destructive creatures.
posted by sswiller at 9:05 AM on August 12, 2009
posted by sswiller at 9:05 AM on August 12, 2009
I hope that the topical jokes come back in style by the time they get there. It would be a real bummer if those far-out folks thought we were fixated on the past, and ignored our messages.
"Seriously, another one asking 'can you hear me now'? We spent three weeks decoding this for a bunch of TV commercial references? Let's go hang out on 70 Virginis b. It's bit warm, but at least they aren't fixated on old jokes."
posted by filthy light thief at 9:13 AM on August 12, 2009
"Seriously, another one asking 'can you hear me now'? We spent three weeks decoding this for a bunch of TV commercial references? Let's go hang out on 70 Virginis b. It's bit warm, but at least they aren't fixated on old jokes."
posted by filthy light thief at 9:13 AM on August 12, 2009
ALL OUR BASE ARE BELONG TO YOU
posted by DU at 9:16 AM on August 12, 2009 [1 favorite]
posted by DU at 9:16 AM on August 12, 2009 [1 favorite]
Frankly, I wish they weren't doing this - active SETI's potential dangers aren't worth it.
We can try adding "IT'S A TRAP!!!" to the outgoing messages.
posted by orme at 9:18 AM on August 12, 2009 [1 favorite]
We can try adding "IT'S A TRAP!!!" to the outgoing messages.
posted by orme at 9:18 AM on August 12, 2009 [1 favorite]
the very first thing they see is Tubgirl.
That's payback, my friend. An advanced race of Mountain Chicken Frogs on Gliese 581d still snickers at the video ancestors chose to beam toward Earth.
posted by prinado at 9:20 AM on August 12, 2009
That's payback, my friend. An advanced race of Mountain Chicken Frogs on Gliese 581d still snickers at the video ancestors chose to beam toward Earth.
posted by prinado at 9:20 AM on August 12, 2009
Dear People of Gliese 581d:
Does your planet have universal healthcare?
Does your planet have NO republicans?
When is the next pickup?
Signed,
Future Gliese 581dian
posted by KevinSkomsvold at 9:20 AM on August 12, 2009
Does your planet have universal healthcare?
Does your planet have NO republicans?
When is the next pickup?
Signed,
Future Gliese 581dian
posted by KevinSkomsvold at 9:20 AM on August 12, 2009
HUMANS ARE STUPID. AVOID EARTH AT ALL COSTS. Although, if you have room, could you come pick me up, I am stupid but I wanna get away from this God awful planet
Seems like Blaine still wants out.
posted by filthy light thief at 9:22 AM on August 12, 2009
Seems like Blaine still wants out.
posted by filthy light thief at 9:22 AM on August 12, 2009
DO YOU HAVE HYPERLORD QUORLAX IN A CAN
posted by boo_radley at 9:26 AM on August 12, 2009 [14 favorites]
posted by boo_radley at 9:26 AM on August 12, 2009 [14 favorites]
AVOID AUSTRALIA
posted by Brandon Blatcher at 9:27 AM on August 12, 2009
posted by Brandon Blatcher at 9:27 AM on August 12, 2009
...active SETI's potential dangers aren't worth it.
If active SETI has any dangers (meaning they'd have to have FTL), then it's definitely worth it (possibly learning FTL).
Hopefully they are sending in both ASCII and EBCDIC.
posted by DU at 9:29 AM on August 12, 2009
If active SETI has any dangers (meaning they'd have to have FTL), then it's definitely worth it (possibly learning FTL).
Hopefully they are sending in both ASCII and EBCDIC.
posted by DU at 9:29 AM on August 12, 2009
There's nobody there.
Oh, THEY're there all right. THEY just don't do radio and it's the narrowest sort of human-centric chauvinism to assume that THEY do.
THEY also don't do space ships. There's far more effective ways to "travel" through curved space.
posted by philip-random at 9:33 AM on August 12, 2009
Oh, THEY're there all right. THEY just don't do radio and it's the narrowest sort of human-centric chauvinism to assume that THEY do.
THEY also don't do space ships. There's far more effective ways to "travel" through curved space.
posted by philip-random at 9:33 AM on August 12, 2009
Gliese 581d: Dear Earth - is your alien ambassador really named Robert'); DROP TABLE ???
posted by marginaliana at 9:46 AM on August 12, 2009 [1 favorite]
posted by marginaliana at 9:46 AM on August 12, 2009 [1 favorite]
Why are there so many pleas for 'them' to save 'us'? Yes, we've done a lot of damage. But if there are aliens out there who can receive our message, decode it, and interpret it, why should they a) care, b) know what to do, and c) come all that way to fix our problems? What if they have problems of their own? What if they need our help?
Anyway, this is cool, and I am enjoying the messages, the hopes and wishes and yearnings being flung out into space. I'm now trying to figure out a message of my own which is not some variant of 'save us!' Or full of scientific truths, because I am not a scientist.
posted by sandraregina at 9:48 AM on August 12, 2009
Anyway, this is cool, and I am enjoying the messages, the hopes and wishes and yearnings being flung out into space. I'm now trying to figure out a message of my own which is not some variant of 'save us!' Or full of scientific truths, because I am not a scientist.
posted by sandraregina at 9:48 AM on August 12, 2009
I seem to be having tremendous difficulties with my lifestyle...
posted by zap rowsdower at 10:01 AM on August 12, 2009
posted by zap rowsdower at 10:01 AM on August 12, 2009
I suspect that any sufficiently advanced civilization who ran across our transmissions and contacted Earth would probably either say 'Hello' in a way that said they think we're insipid little troglodytes who have no clue what galactic crap we're getting into or simply conquer us.
I for one welcome, etc.
posted by kldickson at 10:07 AM on August 12, 2009
I for one welcome, etc.
posted by kldickson at 10:07 AM on August 12, 2009
Oh, this is a spectacular idea. Let's announce our presence to aliens by letting random people tweet at them.
Is it just me, or does the planet earth placed at the end of the word "HELLO" on that page to stand in for the letter "O" not parse as an "O" the first time you read it? So that at first glance it reads "HELL FROM EARTH." Also, something insane seems to be happening with the interface:
Hello from Mexico The best country of the Earth planet...
Amadeo
Guadalajara, Australia
Fucking perfect. If they aren't abducting us and performing horribly invasive and inexplicable probes on us now, I'm sure they'll want to start soon, if only to get us to shut the hell up.
posted by koeselitz at 10:07 AM on August 12, 2009
Is it just me, or does the planet earth placed at the end of the word "HELLO" on that page to stand in for the letter "O" not parse as an "O" the first time you read it? So that at first glance it reads "HELL FROM EARTH." Also, something insane seems to be happening with the interface:
Hello from Mexico The best country of the Earth planet...
Amadeo
Guadalajara, Australia
Fucking perfect. If they aren't abducting us and performing horribly invasive and inexplicable probes on us now, I'm sure they'll want to start soon, if only to get us to shut the hell up.
posted by koeselitz at 10:07 AM on August 12, 2009
DEAR GLIESE 581DESE:
.. ... ..... ....... ...........
PLEASE BRING ETHANOL DRINKS
WE COME IN PEACE, BUT SOME OF US ARE UNFORTUNATELY A BIT DULL
WE APOLOGIZE FOR THE INCONVENIENCE
THANKS
SINCERELY,
EARTH (SOL III), SOL, ORION ARM, MILKY WAY, VIRGO SUPERCLUSTER
posted by kldickson at 10:14 AM on August 12, 2009
.. ... ..... ....... ...........
PLEASE BRING ETHANOL DRINKS
WE COME IN PEACE, BUT SOME OF US ARE UNFORTUNATELY A BIT DULL
WE APOLOGIZE FOR THE INCONVENIENCE
THANKS
SINCERELY,
EARTH (SOL III), SOL, ORION ARM, MILKY WAY, VIRGO SUPERCLUSTER
posted by kldickson at 10:14 AM on August 12, 2009
This is not the planet you are looking for. Move along. Move along.
posted by Danf at 10:30 AM on August 12, 2009
posted by Danf at 10:30 AM on August 12, 2009
You do all realize that all our electromagnetic emissions are already traveling over there, right? They are already going to get a bunch of nonsense, so a few tweets more or less hardly matter.
posted by DU at 10:31 AM on August 12, 2009
posted by DU at 10:31 AM on August 12, 2009
TWEET:
Let's hope there is intelligent life out there in space, 'cause there's bugger all here on earth.
posted by lalochezia at 10:37 AM on August 12, 2009
Let's hope there is intelligent life out there in space, 'cause there's bugger all here on earth.
posted by lalochezia at 10:37 AM on August 12, 2009
I sent an ASCII art portait of Hitler upside down.
posted by Astro Zombie at 10:37 AM on August 12, 2009
posted by Astro Zombie at 10:37 AM on August 12, 2009
ATTEMPT NO LANDING IN THE RED ZONE. VIOLATORS WILL BE TOWED.
posted by zippy at 10:40 AM on August 12, 2009
posted by zippy at 10:40 AM on August 12, 2009
URGENTLY NEED YOUR ASSISTANCE. I REPRESENT SPACE PRINCE MBOKO OF NIGERIA, EARTH
posted by zippy at 10:42 AM on August 12, 2009 [5 favorites]
posted by zippy at 10:42 AM on August 12, 2009 [5 favorites]
FIRST POST
posted by lumpenprole at 10:47 AM on August 12, 2009
posted by lumpenprole at 10:47 AM on August 12, 2009
Youtube - Space Peeple - for background song needed as I write my own message of insanity.
posted by Senator at 10:49 AM on August 12, 2009
posted by Senator at 10:49 AM on August 12, 2009
DO YOU HAVE HYPERLORD QUORLAX IN A CAN
Do not let him out, or he will explosively decompress!
(commence Coneheads-style laughter. AH AH AH)
posted by zippy at 10:49 AM on August 12, 2009 [1 favorite]
Do not let him out, or he will explosively decompress!
(commence Coneheads-style laughter. AH AH AH)
posted by zippy at 10:49 AM on August 12, 2009 [1 favorite]
MOSTLY HARMLESS.
posted by joe lisboa at 10:51 AM on August 12, 2009
posted by joe lisboa at 10:51 AM on August 12, 2009
PLEASE YOUR MATING PARTNER WITH AN ENLARGED REPRODUCTIVE ORGAN
posted by DU at 10:51 AM on August 12, 2009
posted by DU at 10:51 AM on August 12, 2009
ZIPPY MAY I HAVE 55 WORDS WITH YOU
posted by boo_radley at 10:54 AM on August 12, 2009
posted by boo_radley at 10:54 AM on August 12, 2009
"Dear Planet of the Super Powerful Hipsters and Twitter Users: Want to know who's been talking shit about you down here?"
posted by drjimmy11 at 10:59 AM on August 12, 2009
posted by drjimmy11 at 10:59 AM on August 12, 2009
Just you wait, one day we'll pick up the alien equivalent of Twitter posts ourselves. Alien intelligences always seem to be portrayed as doing nothing but serenely and wisely contemplating the majesty of the universe, when I bet any sufficiently developed civilisation will spend as much time faffing around on their version of an Internet as we do.
posted by chorltonmeateater at 11:00 AM on August 12, 2009
posted by chorltonmeateater at 11:00 AM on August 12, 2009
0100110101100001011100100111001100100000010101100110111101101100011
1010001100001001000000101001001001111010000110100101101010011!
posted by Potomac Avenue at 11:28 AM on August 12, 2009
1010001100001001000000101001001001111010000110100101101010011!
posted by Potomac Avenue at 11:28 AM on August 12, 2009
Just you wait, one day we'll pick up the alien equivalent of Twitter posts ourselves.
I was wondering about this. If we had picked up similar but alien Twitter posts at Seti, would we have known them from general universe background noise, quasar pulses etc? I suppose the regular pulsed nature of the 'zeros' and 'ones' that codify the message is a carrier signal that we would recognize and pick-up. Any other insight?
posted by duncan42 at 11:36 AM on August 12, 2009
I was wondering about this. If we had picked up similar but alien Twitter posts at Seti, would we have known them from general universe background noise, quasar pulses etc? I suppose the regular pulsed nature of the 'zeros' and 'ones' that codify the message is a carrier signal that we would recognize and pick-up. Any other insight?
posted by duncan42 at 11:36 AM on August 12, 2009
Neat! Would be even cooler if the messages were transmitted immediately in realtime.
posted by ixohoxi at 11:38 AM on August 12, 2009
posted by ixohoxi at 11:38 AM on August 12, 2009
I imagine somewhere in the universe there is an alien going (apologies to MAD Magazine - I couldn't think of a funnier sounding unit of measurement):
'Want to embiggen your sgnkrxxx? Take this rfvx weed and see it embiggen by 4 potrzebies! Only ♨43.00!
posted by kldickson at 11:49 AM on August 12, 2009
'Want to embiggen your sgnkrxxx? Take this rfvx weed and see it embiggen by 4 potrzebies! Only ♨43.00!
posted by kldickson at 11:49 AM on August 12, 2009
Damn I used a tr.im URL in my message, now my alien rick roll won't work!!!!
posted by bottlebrushtree at 11:50 AM on August 12, 2009 [1 favorite]
posted by bottlebrushtree at 11:50 AM on August 12, 2009 [1 favorite]
Red sun? Check.
Planetary mass significantly larger than ours? Check.
Probably icy? Check.
posted by adipocere at 12:04 PM on August 12, 2009 [1 favorite]
Planetary mass significantly larger than ours? Check.
Probably icy? Check.
WE'RE FROM EARTH, BLUE PLANET, THIRD FROM A YELLOW SUN. HOW ARE YOUR EVACUATION PLANS GOING? YOU WANT A BIGGER SHIP, SEROUSLY. OH AND ABOUT THAT PHANTOM ZONE
posted by adipocere at 12:04 PM on August 12, 2009 [1 favorite]
BOO RADLEY, I RECEIVE YOU FIVE BY FIVE. COMMENCE OPERATION COURIER 12.
posted by zippy at 12:07 PM on August 12, 2009
posted by zippy at 12:07 PM on August 12, 2009
hey aliens why just 160 characters, that's stupid. I don't buy that you have cell phones, cause if you have them why couldn't E.T. call home? splitters. #space
posted by mr.marx at 12:08 PM on August 12, 2009
posted by mr.marx at 12:08 PM on August 12, 2009
I'm leaning toward preemptive attack:
"ATATCGTTATGCTAGTATACGCCTACCCGTCACCGGCCAACAGTGTGCA
GATGGCGCCACGAGTTACTGGCCCTGATTTCTCCGCTTCTAATACCGCA
CACTG"
and hope they'll try combining it with their own DNA. It'll start out looking like a Gliesian, but mutate horribly into a blond nymphomaniac Earthling.
With Base64, we can send 480 nucleotides per SMS. I don't know how many we would need.
posted by kurumi at 12:10 PM on August 12, 2009 [1 favorite]
"ATATCGTTATGCTAGTATACGCCTACCCGTCACCGGCCAACAGTGTGCA
GATGGCGCCACGAGTTACTGGCCCTGATTTCTCCGCTTCTAATACCGCA
CACTG"
and hope they'll try combining it with their own DNA. It'll start out looking like a Gliesian, but mutate horribly into a blond nymphomaniac Earthling.
With Base64, we can send 480 nucleotides per SMS. I don't know how many we would need.
posted by kurumi at 12:10 PM on August 12, 2009 [1 favorite]
Star Trek is a documentary. Please send green-skinned dancers, warp drive parts, Romulan ale ASAP.
posted by zippy at 12:11 PM on August 12, 2009
posted by zippy at 12:11 PM on August 12, 2009
1) This signal isn't strong enough to make it even a fraction of a percent the way there.
2) Even if they did hear it and respond immediately, no one will remember in the 40 years it would take.
3) Nevermind about #2 since there are no plans to even listen for a response.
So if they don't bother to even send the messages this will have the same effect as if they do. How about if we get more robots on Mars and stop screwing around with dumb crap like this.
posted by y6y6y6 at 12:50 PM on August 12, 2009
2) Even if they did hear it and respond immediately, no one will remember in the 40 years it would take.
3) Nevermind about #2 since there are no plans to even listen for a response.
So if they don't bother to even send the messages this will have the same effect as if they do. How about if we get more robots on Mars and stop screwing around with dumb crap like this.
posted by y6y6y6 at 12:50 PM on August 12, 2009
How about if we get more robots on Mars and stop screwing around with dumb crap like this.
Mars needswomen robots.
posted by Avelwood at 1:09 PM on August 12, 2009
Mars needs
posted by Avelwood at 1:09 PM on August 12, 2009
From what I can find on the internets, here is a short list of stars that might have life near them:
- 40 Eridani A
- 82 Eridani
- 70 Ophiuchi A
- Eta Cassiopeiae A
- Delta Pavonis
- Epsilon Eridani
- Iota Horologii
- Pollux
- Vega
- Zeta Reticuli
It's a short list.
posted by kldickson at 1:17 PM on August 12, 2009
- 40 Eridani A
- 82 Eridani
- 70 Ophiuchi A
- Eta Cassiopeiae A
- Delta Pavonis
- Epsilon Eridani
- Iota Horologii
- Pollux
- Vega
- Zeta Reticuli
It's a short list.
posted by kldickson at 1:17 PM on August 12, 2009
Do they have a travel wiki or even a Lonely Planet guide for them?
posted by The Whelk at 1:29 PM on August 12, 2009
posted by The Whelk at 1:29 PM on August 12, 2009
Attention: We understand that the time to do the Kessel Run is not measured in parsecs.
Also, please do not judge us by the Star Wars Christmas Special. However, if you are warlike, be warned that Bea Arthur is representative of our species and is very much alive.
Also, Han shot first.
posted by zippy at 2:08 PM on August 12, 2009
Also, please do not judge us by the Star Wars Christmas Special. However, if you are warlike, be warned that Bea Arthur is representative of our species and is very much alive.
Also, Han shot first.
posted by zippy at 2:08 PM on August 12, 2009
From what I can find on the internets, here is a short list of stars that might have life near them:
Sol not included. I guess the boffins didn't try us on a weekend.
posted by dhartung at 2:17 PM on August 12, 2009
Sol not included. I guess the boffins didn't try us on a weekend.
posted by dhartung at 2:17 PM on August 12, 2009
We apologize for Robin Williams. Seriously.
posted by CunningLinguist at 3:56 PM on August 12, 2009
posted by CunningLinguist at 3:56 PM on August 12, 2009
Do you have any spare dinosaurs? We miss ours terribly.
posted by Pronoiac at 5:43 PM on August 12, 2009
posted by Pronoiac at 5:43 PM on August 12, 2009
From what I can find on the internets, here is a short list of stars that might have life near them...
It's a short list.
It's a short internet search then! Or it's a list of favorite Earth-like solar scenarios, but certainly not the only stars with life in their systems.
Drake estimated "10,000 planets containing intelligent life, with the possible capability of communicating with Earth in the Milky Way galaxy."
And of course we're only one of billions of galaxies...
posted by hypersloth at 6:56 PM on August 12, 2009
It's a short list.
It's a short internet search then! Or it's a list of favorite Earth-like solar scenarios, but certainly not the only stars with life in their systems.
Drake estimated "10,000 planets containing intelligent life, with the possible capability of communicating with Earth in the Milky Way galaxy."
And of course we're only one of billions of galaxies...
posted by hypersloth at 6:56 PM on August 12, 2009
*which might have life in their systems
*hundreds of billions of galaxies
posted by hypersloth at 7:19 PM on August 12, 2009
*hundreds of billions of galaxies
posted by hypersloth at 7:19 PM on August 12, 2009
I'm just having trouble figuring out what 'hell of Rome arth' means.
posted by stavrosthewonderchicken at 1:50 AM on August 13, 2009
posted by stavrosthewonderchicken at 1:50 AM on August 13, 2009
Gliese 581d replies. STFU noobs. Fucking eternal September.
posted by Zed at 8:06 AM on August 13, 2009
posted by Zed at 8:06 AM on August 13, 2009
« Older Penis information | Today your destiny becomes fate! Newer »
This thread has been archived and is closed to new comments
posted by Pater Aletheias at 7:39 AM on August 12, 2009 [7 favorites]