First virus antibiotic has been (partially) figured out.
October 15, 2014 5:12 PM Subscribe
How is this different than existing antivirals? I read the article, and calling it "natural" doesn't, to me, make it better than existing antiviral medicines. Building on what RolandOfEld says, why is this analogous to penicillin, other than being "natural"?
posted by mollweide at 5:22 PM on October 15, 2014 [2 favorites]
posted by mollweide at 5:22 PM on October 15, 2014 [2 favorites]
I think they said it's "found naturally" because artificially growing viral antibodies in plants is a common method, so the distinction perhaps.
posted by stbalbach at 5:27 PM on October 15, 2014
posted by stbalbach at 5:27 PM on October 15, 2014
a molecule found naturally in a Chinese herb called honeysuckle.
?
L. japonica is Japanese honeysuckle. It's right there in the Latin. It certainly grows in China, but then again it thrives pretty much everywhere in the northern hemisphere.
posted by Iridic at 5:29 PM on October 15, 2014 [1 favorite]
?
L. japonica is Japanese honeysuckle. It's right there in the Latin. It certainly grows in China, but then again it thrives pretty much everywhere in the northern hemisphere.
posted by Iridic at 5:29 PM on October 15, 2014 [1 favorite]
Iridic - I think the idea is that honeysuckle is used in traditional Chinese herbal medicine.
posted by Amplify at 5:38 PM on October 15, 2014 [1 favorite]
posted by Amplify at 5:38 PM on October 15, 2014 [1 favorite]
Iridic -- according to Wikipedia, L. japonica is native to China, Korea, and Japan. The naming rights doesn't mean it belongs to one country or another.
posted by watermelon at 5:46 PM on October 15, 2014
posted by watermelon at 5:46 PM on October 15, 2014
It's like if scientists had discovered a natural antivirus in an old English folk remedy of listening to the French Horn.
posted by iotic at 5:52 PM on October 15, 2014 [7 favorites]
posted by iotic at 5:52 PM on October 15, 2014 [7 favorites]
that's nonsense, iotic - everyone knows the true french remedy of listening to the cor anglais
posted by pyramid termite at 5:57 PM on October 15, 2014 [7 favorites]
posted by pyramid termite at 5:57 PM on October 15, 2014 [7 favorites]
Cor, blimey!
posted by Ice Cream Socialist at 6:06 PM on October 15, 2014 [1 favorite]
posted by Ice Cream Socialist at 6:06 PM on October 15, 2014 [1 favorite]
hautboy, here we go again
posted by Earthtopus at 6:19 PM on October 15, 2014 [9 favorites]
posted by Earthtopus at 6:19 PM on October 15, 2014 [9 favorites]
"Chinese medicine" is a style of medicine that is also practiced in Japan, for example. It's still called Chinese medicine despite being practiced in Japan (and other countries), so L. Japonica can still be called a Chinese herb.
The reason why L.Japonica is classified as such is likely because the first person to use Linnaean taxonomy to describe the plant probably encountered it in Japan.
posted by Nevin at 6:20 PM on October 15, 2014 [2 favorites]
The reason why L.Japonica is classified as such is likely because the first person to use Linnaean taxonomy to describe the plant probably encountered it in Japan.
posted by Nevin at 6:20 PM on October 15, 2014 [2 favorites]
Link to the paper. The crazy part to me is that the antiviral element they identify is a microRNA, and one that apparently manages to survive 30 minutes of boiling (most DNA and RNA elements fall apart rapidly with heat, acid, etc.). I'm still really surprised that it apparently makes it through the stomach and into the blood intact -- that's pretty unprecedented for a (non-synthetic) nucleic acid AFAIK.
posted by en forme de poire at 6:31 PM on October 15, 2014 [6 favorites]
posted by en forme de poire at 6:31 PM on October 15, 2014 [6 favorites]
Because it's a miRNA, it shouldn't work on viruses that aren't closely related to influenza (at least not for this reason) - miRNAs bind to specific bits of sequence in gene transcripts, so if those bits of sequence aren't present, it has no effect.
posted by en forme de poire at 6:33 PM on October 15, 2014
posted by en forme de poire at 6:33 PM on October 15, 2014
It's like if scientists had discovered a natural antivirus in an old English folk remedy of listening to the French Horn.
Or perhaps if listening to the violin could cure ebola...
posted by sobarel at 7:10 PM on October 15, 2014
Or perhaps if listening to the violin could cure ebola...
posted by sobarel at 7:10 PM on October 15, 2014
Yeah - a quick read suggests that "penicillin" is a really bad analogy - if this miRNA can be successfully formulated and is potent in humans, it's limitations from this study are summed up by the last sentence of the abstract:
In the present study, we showed that [this chemical] directly targets various influenza A subtypes both in vitro and in vivo.
Nothing further is detailed - it's very novel that this compound targets a virus at all, and IFV-A is a big mortality agent, but it's not so far a broad spectrum antiviral that merits the penicillin tag.
posted by cromagnon at 7:18 PM on October 15, 2014 [4 favorites]
In the present study, we showed that [this chemical] directly targets various influenza A subtypes both in vitro and in vivo.
Nothing further is detailed - it's very novel that this compound targets a virus at all, and IFV-A is a big mortality agent, but it's not so far a broad spectrum antiviral that merits the penicillin tag.
posted by cromagnon at 7:18 PM on October 15, 2014 [4 favorites]
The reason why L.Japonica is classified as such is likely because the first person to use Linnaean taxonomy to describe the plant probably encountered it in Japan.
Yup - the complete Latin name with author citation is Lonicera japonica Thunb., meaning Carl Peter Thunberg, who collected and described (i.e., gave a Latin name to) many plants in Japan in the 1770s.
A line of interest from Wikipedia: "Many of the plants which he gave the epithet "japonica" were actually Chinese plants which had been introduced into Japan, and many plants which he described as living in the wild were actually garden plants."
The varietal name Lonicera japonica var. chinensis has been used, but isn't currently accepted as taxonomically distinct.
This has been your botanical nomenclature diversion for the day, because I am a big ol' nerd.
posted by pemberkins at 8:01 PM on October 15, 2014 [21 favorites]
Yup - the complete Latin name with author citation is Lonicera japonica Thunb., meaning Carl Peter Thunberg, who collected and described (i.e., gave a Latin name to) many plants in Japan in the 1770s.
A line of interest from Wikipedia: "Many of the plants which he gave the epithet "japonica" were actually Chinese plants which had been introduced into Japan, and many plants which he described as living in the wild were actually garden plants."
The varietal name Lonicera japonica var. chinensis has been used, but isn't currently accepted as taxonomically distinct.
This has been your botanical nomenclature diversion for the day, because I am a big ol' nerd.
posted by pemberkins at 8:01 PM on October 15, 2014 [21 favorites]
I stand corrected!
posted by Iridic at 8:29 PM on October 15, 2014 [2 favorites]
posted by Iridic at 8:29 PM on October 15, 2014 [2 favorites]
Thanks, en forme de poire and cromagnon, I was looking for better informed opinions than mine on the penicillin analogy.
posted by mollweide at 8:38 PM on October 15, 2014
posted by mollweide at 8:38 PM on October 15, 2014
Hah! This is far from our most prevalent or environmentally threatening invasive species, but it's common enough that as kids we spent whole school holidays drunk on the nectar, and authoritatively telling each other that the berries were deadly poisonous. DEADLY!
(Yeah? Don't believe me? Dare ya!!!)
posted by Ahab at 9:38 PM on October 15, 2014 [2 favorites]
(Yeah? Don't believe me? Dare ya!!!)
posted by Ahab at 9:38 PM on October 15, 2014 [2 favorites]
Huh, a microRNA delivered orally? That is incredibly remarkable, and I wonder if the miRNA has some secondary structure that protects it on the digestive journey from mouth to bloodstream. Usually with RNA therapy the really exciting thing is that 1) it's highly targeted to a specific thing, and 2) one could retarget it to nearly whatever one wants by changing the sequence, but I have a feeling that modifying this sequence would make it more digestible, therefore eliminating possibility 2.
It's a big year all around for RNA therapeutics. Two muscular dystrophy RNA therapies (delivered intravenously or subcutaneously, NOT orally) are showing better than hoped for results, and now there's apparently an RNA natural product too. Maybe this will breath some more life into the waning field of natural product chemistry.
posted by Llama-Lime at 10:51 PM on October 15, 2014 [5 favorites]
It's a big year all around for RNA therapeutics. Two muscular dystrophy RNA therapies (delivered intravenously or subcutaneously, NOT orally) are showing better than hoped for results, and now there's apparently an RNA natural product too. Maybe this will breath some more life into the waning field of natural product chemistry.
posted by Llama-Lime at 10:51 PM on October 15, 2014 [5 favorites]
Since I have some honeysuckle growing out back, my question was: What part of the plant is used to make the tea? This site says it's the flowers, but pictures on some other sites look like dried leaves. Anyone know?
posted by Kirth Gerson at 3:50 AM on October 16, 2014
posted by Kirth Gerson at 3:50 AM on October 16, 2014
I wanna know how honeysuckle miRNA hit upon a silencing role against a human and swine virus. What does it do for the honeysuckle? Granted that much distance and such a short sequence means the odds aren't dauntingly high, but... seriously, what?
posted by Made of Star Stuff at 4:56 AM on October 16, 2014
posted by Made of Star Stuff at 4:56 AM on October 16, 2014
I won't be convinced it works until Donald Rumsfeld invests in it.
posted by InsertNiftyNameHere at 8:33 AM on October 16, 2014
posted by InsertNiftyNameHere at 8:33 AM on October 16, 2014
This also isn't close to the first "virus antibiotic" or antiviral (AZT, acylovir, oseltamivir...). I guess it might be the first that's a natural product and that is delivered orally as opposed to being part of an innate immune system?
posted by en forme de poire at 10:48 AM on October 16, 2014
posted by en forme de poire at 10:48 AM on October 16, 2014
I wanna know how honeysuckle miRNA hit upon a silencing role against a human and swine virus.
Accident? Something that the miRNA does also codes against something that would hurt honeysuckle?
posted by feckless fecal fear mongering at 12:01 PM on October 16, 2014
Accident? Something that the miRNA does also codes against something that would hurt honeysuckle?
posted by feckless fecal fear mongering at 12:01 PM on October 16, 2014
OK wait hold on, something is fishy about this. In the intro they state: "On the other hand, our previous study has shown that MIR168a derived from food plants can pass through the gastrointestinal (GI) tract and enter into the circulation and various organs of mice." But then when I looked at the cited paper, I actually found three rebuttals: one, two, three. Nothing they said in the new paper seems totally implausible to me but at the same time, if this is their track record I'm inclined to be a little skeptical until it's replicated by another group.
posted by en forme de poire at 2:15 PM on October 16, 2014 [2 favorites]
posted by en forme de poire at 2:15 PM on October 16, 2014 [2 favorites]
Several comments from a computational geneticist whose knowledge of viruses extends to what I have gleaned from conversations with my virologist girlfriend:
1. Apologies for being pedantic, but an antibiotic is a drug that kills bacteria or inhibits bacterial replication; a vaccine is the correct term to use for a drug that targets a virus. The appropriateness of the penicillin metaphor is debatable.
2. I agree with en forme de poire: one of the coolest things about this paper is the fact that the virus survives hours of boiling AND that it's resistant to RNAse (a class of enzymes that degrade RNA). However, as they point out in the paper, this is a "special" miRNA for just that reason. They did the experiment where they mutated several of the bases and showed that the mutated miRNA was no longer RNAse-resistant, so, sorry Llama-Lime but this won't be a catch-all approach to antivirals.
3. On the other hand, en forme de poire, miRNAs are short (this one is 20 nucleotides long) and it is possible by chance that a plant-derived miRNA will have a sequence that inhibits a viral protein. miRNAs also behave differently in different organisms; in plants they typically inhibit by binding for their full length, while in animals partial binding is common. I do not know how miRNAs work in viruses. It's also plausible that the the original target of the plant miRNA was a highly conserved domain of a gene in a plant virus that also appears in H1N1 and other flu strains. For a fun exercise, go here: http://www.ncbi.nlm.nih.gov/blast/Blast.cgi, and enter the sequence of the miRNA: GGCCGGGGGACGGACUGGGA. My results showed 54 hits to flu strains, many of them with high identity (> 90%).
4. My reading of the paper is that, in order to get the titer of the miRNA high enough in the lungs to have a significant effect, they had to first prepare a high-concentration decoction and then either gavage-feed the mice or provide the decoction as their only liquid source (continuous drinking). Mice are small. To get the same effect in humans would require ingesting a huge amount of honeysuckle decoction. This seems like an interesting avenue to pursue for a pharmaceutical, in which large numbers of synthesized miRNA are delivered to the lungs in a targeted fashion. Synthesizing short oligos in large numbers is dirt cheap; the targeting part I'm not so sure about. As en forme de poire mentions, the ability of miRNA to survive the digestive track and pass into the bloodstream is something that's controversial and an active area of research. Given the interesting properties of this particular miRNA, however, I'm thinking if any miRNA is going to survive it's that little guy.
posted by infinitemonkey at 5:45 AM on October 17, 2014 [1 favorite]
1. Apologies for being pedantic, but an antibiotic is a drug that kills bacteria or inhibits bacterial replication; a vaccine is the correct term to use for a drug that targets a virus. The appropriateness of the penicillin metaphor is debatable.
2. I agree with en forme de poire: one of the coolest things about this paper is the fact that the virus survives hours of boiling AND that it's resistant to RNAse (a class of enzymes that degrade RNA). However, as they point out in the paper, this is a "special" miRNA for just that reason. They did the experiment where they mutated several of the bases and showed that the mutated miRNA was no longer RNAse-resistant, so, sorry Llama-Lime but this won't be a catch-all approach to antivirals.
3. On the other hand, en forme de poire, miRNAs are short (this one is 20 nucleotides long) and it is possible by chance that a plant-derived miRNA will have a sequence that inhibits a viral protein. miRNAs also behave differently in different organisms; in plants they typically inhibit by binding for their full length, while in animals partial binding is common. I do not know how miRNAs work in viruses. It's also plausible that the the original target of the plant miRNA was a highly conserved domain of a gene in a plant virus that also appears in H1N1 and other flu strains. For a fun exercise, go here: http://www.ncbi.nlm.nih.gov/blast/Blast.cgi, and enter the sequence of the miRNA: GGCCGGGGGACGGACUGGGA. My results showed 54 hits to flu strains, many of them with high identity (> 90%).
4. My reading of the paper is that, in order to get the titer of the miRNA high enough in the lungs to have a significant effect, they had to first prepare a high-concentration decoction and then either gavage-feed the mice or provide the decoction as their only liquid source (continuous drinking). Mice are small. To get the same effect in humans would require ingesting a huge amount of honeysuckle decoction. This seems like an interesting avenue to pursue for a pharmaceutical, in which large numbers of synthesized miRNA are delivered to the lungs in a targeted fashion. Synthesizing short oligos in large numbers is dirt cheap; the targeting part I'm not so sure about. As en forme de poire mentions, the ability of miRNA to survive the digestive track and pass into the bloodstream is something that's controversial and an active area of research. Given the interesting properties of this particular miRNA, however, I'm thinking if any miRNA is going to survive it's that little guy.
posted by infinitemonkey at 5:45 AM on October 17, 2014 [1 favorite]
Without getting too much into it, gene therapy for long-term delivery of miRNAs is now pretty routine in animals and, while I'm not aware of any ongoing clinical trials, use in humans can't be far away. The examples that spring to mind are an miRNA that targets Hepatitis C virus (synthetic, but otherwise the same basic idea as this anti-flu miRNA), and one that aims to silence miRNAs that are important in the survival/progression/metastasis of some hepatocellular carcinomas.
Getting stable, long-term expression of therapeutic genes in lung cells is tricky (if it were easy, we'd have cured cystic fibrosis by now), and long-term expression is important, because after the first treatment with a given therapeutic virus you (probably) become immune to it, and can't easily have a second dose.* But long-term expression in certain other tissues seems fine, with several clinical trials going on right now. Given how stable this sequence is, I'd bet that you could express it in e.g. the liver, and rely on the bloodstream to carry it to the lungs. If the concentrations get high enough without causing any harm to the patient, that person would be resistant to the flu for years, perhaps for life.
Of course, you'd expect resistance to develop at some point, and the group's success at making a resistant strain in the lab suggests that it'd evolve pretty quickly in the wild. Still a tempting experiment to try, though. Gene therapy vectors aren't hard to make if your lab is geared up for it: they could plausibly be getting early efficacy data within a couple of months, assuming they have the funding and a postdoc or two to throw at it.
*There are ways around this. Giving a second dose with another serotype (mostly the same virus, but just different enough that your immune system doesn't recognise it), use of immunosuppression, etc. Promising animal data, but no method is without its problems. None have been tried yet in humans AFAIK, so I wouldn't want to bet on it yet as part of a therapeutic strategy. Someday, for sure.
posted by metaBugs at 9:11 AM on October 17, 2014 [1 favorite]
Getting stable, long-term expression of therapeutic genes in lung cells is tricky (if it were easy, we'd have cured cystic fibrosis by now), and long-term expression is important, because after the first treatment with a given therapeutic virus you (probably) become immune to it, and can't easily have a second dose.* But long-term expression in certain other tissues seems fine, with several clinical trials going on right now. Given how stable this sequence is, I'd bet that you could express it in e.g. the liver, and rely on the bloodstream to carry it to the lungs. If the concentrations get high enough without causing any harm to the patient, that person would be resistant to the flu for years, perhaps for life.
Of course, you'd expect resistance to develop at some point, and the group's success at making a resistant strain in the lab suggests that it'd evolve pretty quickly in the wild. Still a tempting experiment to try, though. Gene therapy vectors aren't hard to make if your lab is geared up for it: they could plausibly be getting early efficacy data within a couple of months, assuming they have the funding and a postdoc or two to throw at it.
*There are ways around this. Giving a second dose with another serotype (mostly the same virus, but just different enough that your immune system doesn't recognise it), use of immunosuppression, etc. Promising animal data, but no method is without its problems. None have been tried yet in humans AFAIK, so I wouldn't want to bet on it yet as part of a therapeutic strategy. Someday, for sure.
posted by metaBugs at 9:11 AM on October 17, 2014 [1 favorite]
Yeah I can totally believe that if this miRNA worked as advertised, it would work on a whole cluster of phylogenetically related viruses; my point was just that it's probably not going to be a broad spectrum antiviral because some bit of the target sequence still needs to be there and viruses are such a polyphyletic group.
posted by en forme de poire at 9:16 AM on October 17, 2014
posted by en forme de poire at 9:16 AM on October 17, 2014
infinitemonkey, which database(s) are you BLASTing against? I know I'm being dim, but I can't work out which (other than nr/nt) would be likely to contain viral sequences, and none of the ones I've tried have yielded anything viral, even Influenza. nr/nt just pulls up hits from loads of plants, as you'd expect.
en forme de poire, I see what you mean about those rebuttals. I've only skimmed them, but they are concerning, particularly the one in RNA from June 2014.
also: ...it's probably not going to be a broad spectrum antiviral because some bit of the target sequence still needs to be there and viruses are such a polyphyletic group.
I agree. Embarrassingly I can't work out how to BLAST against viral genome databases, but that should predict perfectly which viruses it'll work against, and I'd be really surprised if there's anything much outside Influenza A. And, as you say, while miRNA therapy against other viruses is being considered (I mentioned HCV above), the remarkable stability of this one isn't likely to be something we can take and apply to any of them.
"Antibiotic for viruses" isn't a terrible analogy, but suggesting that it's broad-spectrum (penicillin) is way off-base. Better to just call it an antiviral and have done with.
posted by metaBugs at 9:55 AM on October 17, 2014
en forme de poire, I see what you mean about those rebuttals. I've only skimmed them, but they are concerning, particularly the one in RNA from June 2014.
also: ...it's probably not going to be a broad spectrum antiviral because some bit of the target sequence still needs to be there and viruses are such a polyphyletic group.
I agree. Embarrassingly I can't work out how to BLAST against viral genome databases, but that should predict perfectly which viruses it'll work against, and I'd be really surprised if there's anything much outside Influenza A. And, as you say, while miRNA therapy against other viruses is being considered (I mentioned HCV above), the remarkable stability of this one isn't likely to be something we can take and apply to any of them.
"Antibiotic for viruses" isn't a terrible analogy, but suggesting that it's broad-spectrum (penicillin) is way off-base. Better to just call it an antiviral and have done with.
posted by metaBugs at 9:55 AM on October 17, 2014
Sorry for the incomplete BLAST instructions...I guess it's a bit trickier than I made it out to be, mostly because of poor web design.
1. Go here: http://www.ncbi.nlm.nih.gov/genomes/FLU/FLU.html
2. Enter GGCCGGGGGACGGACUGGGA in the box
3. Click the "Adv BLAST" button
4. Under "Program Selection" click "discontinuous megablast"
5. Click the "BLAST" button
6. Wait a few seconds for the results
7. Profit?
posted by infinitemonkey at 6:49 PM on October 18, 2014 [1 favorite]
1. Go here: http://www.ncbi.nlm.nih.gov/genomes/FLU/FLU.html
2. Enter GGCCGGGGGACGGACUGGGA in the box
3. Click the "Adv BLAST" button
4. Under "Program Selection" click "discontinuous megablast"
5. Click the "BLAST" button
6. Wait a few seconds for the results
7. Profit?
posted by infinitemonkey at 6:49 PM on October 18, 2014 [1 favorite]
« Older I killed the monster. Goodnight. | I too have flattened India Newer »
This thread has been archived and is closed to new comments
MIR2911 is the ‘virological penicillin’
... did they really just find something that [maybe, could be, possibly] is as big a deal as penicillin was back in the day?
posted by RolandOfEld at 5:18 PM on October 15, 2014