The Unqualified Reservations of Mencius Moldbug
October 29, 2007 2:59 PM   Subscribe

Unqualified Reservations is a fascinating ongoing commentary on society and governance in postmodernity. He's currently on about the pwning of Richard Dawkins, after writing about Mediocracy and Official Journalism. It might be best to first read his earlier posts in which he defines the self-invented terminology he's fond of using, like: Formalism, The Iron Polygon, Universalism, Neocameralism, and The Rotary System.

I stumbled upon this blog after another blog linked to Mencius' posts about the role of Graduate Schools in Computer Science Research, and I got drawn in! His posts are long, and the comment threads on them are exceptionally longwinded and well-reasoned as well. Be warned, you could easily lose a whole day reading through his archives, as I did.

Part of what's so fascinating about it is that he often writes from the perspective of hundreds of years in the future, discussing present society as if it's major features had been distilled and anthologized for many generations already.
posted by blasdelf (44 comments total) 10 users marked this as a favorite

This guy thinks genes are "digital"?
Genes are digital and "memes" are not. This is quite sufficient to shatter any logical abstraction.
That struck me as a very dumb thing to say. For one thing, genes are very much lossy, a minor change may or may not change the resulting protean and they are parts of complicated lossy networks. They are certainly "lower level" then verbal expressions of ideas, I guess (but ideas are still encoded physically on some level). But still, that's an awfully big assumption to be throwing out there.

Not that I'm a supporter of "Memetic theory" or anything.
posted by delmoi at 3:05 PM on October 29, 2007


Internet kookery is officially boring now.
posted by tkchrist at 3:14 PM on October 29, 2007 [1 favorite]


The posts I linked to total at least 50,000 words, not even including comments. Surely you can't have read but a fraction of that to form your appraisal.

Metafilter: TL;DR
posted by blasdelf at 3:22 PM on October 29, 2007 [1 favorite]


Actually, this stuff looks really good. I'm drunk now, so what do I know -- anything is too smart for me. But tomorrow I'm gonna be reading this to beat the band and getting zero work done. So fuck you for posting this!

On second thought: holy shit his posts are long! This just killed my whole week.
posted by creasy boy at 3:24 PM on October 29, 2007


Yumpin' yimminy! This is some intellectual shit for something with "pwned" in the title.
posted by infinitywaltz at 3:32 PM on October 29, 2007


(Fortunately the practice known, in what calls itself the real world, as "editing," is considered unethical on a blog - and rightly so.)

Wow. Just wow.
posted by god hates math at 3:40 PM on October 29, 2007


At the risk of impertinence, I have to say I am so fucking sick of seeing whatever that Blogspot layout is.
posted by jayder at 3:47 PM on October 29, 2007


Reading this while drunk is like spotting an ugly girl in a bar and thinking her very attractive. Eitheer stay drunk or, sober, move on.
posted by Postroad at 3:47 PM on October 29, 2007


This guy has way too much time on his hands.
posted by Dasein at 3:50 PM on October 29, 2007


I got a handful of paragraphs into the "Dawkins got pwned" essay and gave up once I recognised the masturbation.

Masturbating is fine, but unless the masturbator is particularly attractive or masturbating in a particularly interesting way, it's really of no interest to anyone but the masturbator.
posted by Pope Guilty at 3:52 PM on October 29, 2007 [5 favorites]


Blogger likes himself. A lot.

On preview, what Pope Guilty said.
posted by Mental Wimp at 4:09 PM on October 29, 2007


I read the first few paragraphs of Iron Polygon and got tired of the relatively unsophisticated notions of power, poorly explored thoughts, and sweeping ahistorical generalizations.

He's someone who went to CS grad school <21 years old, and obviously thinks very highly of anything he cares to say.
posted by a robot made out of meat at 4:13 PM on October 29, 2007


I have come across this blog before, and it's worth pointing out that the author is very far right indeed, if in a more sophisticated way than one usually sees. See this post to get an idea of what I mean. Also note the link to Steve Sailer in the blogroll.

I don't mean this as a way of saying that he shouldn't be read, or anything, but it's worth keeping in mind. I might have a longer response to some things if I find the time and inclination...
posted by a louis wain cat at 4:14 PM on October 29, 2007


Clicking grad school: The overwhelming fact of the modern world is that universities are not merely the charming, bucolic gardens of knowledge that they pretend to be.

Really.
posted by a robot made out of meat at 4:14 PM on October 29, 2007


Surely you can't have read but a fraction of that to form your appraisal.

You are correct I read a fraction of it. And my eyes glazed over and I bit out my tongue just to relive the boredom.

Then I got distracted by a rolling ball of yarn and ran out into traffic.

C'mon.

If the dude can't get to some sort of coherent point with in... say 1200 words... without saying things like "pwned" 50 times and using invented magical terminology thus forcing me the reader into constant digression and self-"glossarizing" (there I did it too!) to know what the fuck he is talking about ... well said writer is a pompous tool.
posted by tkchrist at 4:19 PM on October 29, 2007 [1 favorite]


Here is another coined term: Dick-tatorship.

It can be used to describe a self important blog.
posted by Samuel Farrow at 4:27 PM on October 29, 2007 [2 favorites]


...relive the boredom.

I did that too. But it's better to "relieve" the boredom where possible.
posted by tkchrist at 4:36 PM on October 29, 2007


So I just peaked in and got stuck on this:

He thinks he's a Galileo, Vavilov or Darwin. But if my perspective is accurate, Professor Dawkins is more a Caccini, Lysenko or Wilberforce.

OK... Vavilov was a victim of Lysenkoism, which was later debunked as the crop yields failed and Lysenko was revealed to be a fraud. The other two... Galileo vs. Caccini? An astronomer vs. a composer? Darwin vs. Wilberforce? The most important biologist of the 19th century vs. a revered Christian abolitionist?

I don't get what he's getting at.

And also, his definition of Universalism is very fast and very loose. Saying that Calvinism has anything in common with it is like saying Scientology and Hinduism are one in the same.

Maybe the point of this is that it's a 50,000 word pwnage of anyone reading this looking for substance.
posted by dw at 4:44 PM on October 29, 2007 [3 favorites]


To be fair, tkchrist, he only uses the word pwned to describe the state of Richard Dawkins — that Dawkins is a hardcore Universalist, and that Universalism is the foundation of Protestantism.

The earlier non-dawkins posts feel like they are written from the perspective of a future historian living in a 'neocameralist' state looking back on Western Democracy and it's foibles. It sometimes comes off as quite fascist (and he appears to readily admit this).

He definitely writes too verbosely, but when he inevitably edits it into non-blog form I think it will be much more coherent. (It's kind of begging to be published as a book so it can be misinterpreted by the next generation of College Republicans)

I find it pretty funny that the comments on his blog are longer (big surprise), more intelligent, and far more critical of his ideas than the comments in this thread.

The posts on Mediocracy and Official Journalism are his strongest — I kind of wish I had found the blog and made this post back in September, as to avoid the patented Dawkins Derail.
posted by blasdelf at 4:44 PM on October 29, 2007


posted "he defines the self-invented terminology he's fond of using"

Hmm, autodidact and unacknowledged genius, or internet crank?

Or in my self-invented erminology, daVinci-ity or TimeCube-y?
posted by orthogonality at 4:57 PM on October 29, 2007


delmoi: "That struck me as a very dumb thing to say. For one thing, genes are very much lossy, a minor change may or may not change the resulting protean and they are parts of complicated lossy networks."

Didn't really get through the link, but, um, "digital" and "lossy" aren't at all two different options. Something can very easily be both or neither. The CDs on the floor of my car are extremely digital and extremely lossy. The records in my collection at home aren't either.

And genes, which are a string of GATC switches, are definitely digital; they are also lossy.
posted by koeselitz at 5:00 PM on October 29, 2007


the pwning of Richard Dawkins

someone read him these articles, he fell asleep and woke up in a basement in the vatican with a group of priests ready to "holywaterboard" him

right?
posted by pyramid termite at 5:14 PM on October 29, 2007


> This guy thinks genes are "digital"?

If you unpack them down to the DNA level, they are. Base 4 (CGCCAGGGTTTTCCCAGTCACG) instead of base 2 (10011100001010).
posted by jfuller at 5:36 PM on October 29, 2007


I have come across this blog before, and it's worth pointing out that the author is very far right indeed, if in a more sophisticated way than one usually sees. See this post to get an idea of what I mean. Also note the link to Steve Sailer in the blogroll.

For me, it was the link to Climate Audit.
posted by longdaysjourney at 5:49 PM on October 29, 2007


A perceptive reader does not need 50,000 words to determine that "Mencius Moldbug" is a long-winded pretentious self-important ass whose method of reasoning is flawed at best, but more likely dishonest, and his writings are wordporn for mental masturbaters. I'm billing blasdelf at my normal hourly rate for the time I wasted reading as much as I did and writing this response, which I fear is more elaborate and wordy than I normally would write, but apparently "Unqualified Reservations" contains some kind of mental 'virus' that causes unnecessary pomposity. Then again, there is always the possibility that the aptly named "Mr. Moldbug" is a self-parody along the lines of Stephen Colbert, but without an adequate sense of humor.
posted by wendell at 5:57 PM on October 29, 2007


If you unpack them down to the DNA level, they are. Base 4 (CGCCAGGGTTTTCCCAGTCACG) instead of base 2 (10011100001010).

Not entirely - in a digital system, the meaning is only found in the 1s and 0s. In an analog system, meaning can be found in the structure of the numbers, their positions, their color, etc etc. 110001010 can mean something different from 110001010, 1 1 000 1010, 110001010, etc. Another example is ASCII text as compared to a formatted document.

Obviously any given analog system can be converted to a digital system by encoding all relevant information, but without knowing exactly what information is relevant, this can't be done without information loss. Even if you thought at the time that you'd encoded all relevant information, it may turn out that you hadn't. CGCCAGGGTTT... encodes some of the information in DNA, but not all of it. The angles at which complex molecules fold, to give just one example, is vitally important.
posted by aeschenkarnos at 6:01 PM on October 29, 2007


I find it pretty funny that the comments on his blog are longer (big surprise), more intelligent, and far more critical of his ideas than the comments in this thread.

The desire to engage this boob in debate seems to me a contraindicator of intelligence, and it speaks better-than-usual for the MetaFilter membership that we are not drawn into his silly little game (could it be a 'honeypot' to draw liberal thinkers into wasting their time and intellect on elaborate yet meaningless debate, instead of doing something more valuable to humanity?)
posted by wendell at 6:07 PM on October 29, 2007


I find it pretty funny that the comments on his blog are longer (big surprise), more intelligent, and far more critical of his ideas than the comments in this thread.

big post with big words gimme big headache - ugh - wariz LOLZCATZ???
posted by pyramid termite at 6:21 PM on October 29, 2007


This guy is a reasonably well disguised idiot.

Is this a self-link? I ask because you are kind of a dick (tl;dr, etc.) in nearly exactly the same way that the author of this blog is a dick.

Beyond that... links to highfalutin blogs denying climate science, denying racism and other nutty subjects.

I want my fifteen minutes back.
posted by Tacos Are Pretty Great at 6:27 PM on October 29, 2007 [1 favorite]


Of course, I am just a humble blogger and I have no control at all over history. Sometimes I write out my screeds in tiny, cramped longhand, and staple them to telephone poles. You, dear reader, should treat them as if you found them that way. After all, anyone can start a blog.
posted by monju_bosatsu at 6:57 PM on October 29, 2007 [1 favorite]


And genes, which are a string of GATC switches, are definitely digital; they are also lossy.

Ya, except that, as far as I can tell, there is clear proof that such a simplistic interpretation of genetics is completely inadequate for describing real life phenomena - e.g. epigenetics (great talk by Susannah Varmuza, but useless without pics). Not that I know anything much about the topic, but..
posted by Chuckles at 6:59 PM on October 29, 2007


I don’t know what the hell is going on in any of those. All I’m getting is pops and whistles.

“Galileo vs. Caccini?”

Galileo, he’s got the reach.

“Darwin vs. Wilberforce? The most important biologist of the 19th century vs. a revered Christian abolitionist?”

Well, yeah, it was billed that way, but it got canceled because Darwin couldn’t make the weight. Ironic really.
posted by Smedleyman at 7:03 PM on October 29, 2007


Galileo vs. Caccini? Darwin vs. Wilberforce?

I don't think they were supposed to be matched pairs, he would have written them that way if he did.

Is this a self-link?…

No. I wasn't in graduate school doing Computer Science research and arguing with Mike Godwin on Usenet in 1993 — I was in the second grade (I didn't get on Usenet until at least 1996).

links to highfalutin blogs denying climate science, denying racism and other nutty subjects

I don't agree with much of what he says, and I doubt he agrees with everything on the sites in his blogroll. Guess who else was a vegetarian? That's right. There's nothing on his blog denying those things, but he has written stuff about how the 'official press' set the agenda for public thought.
posted by blasdelf at 8:05 PM on October 29, 2007


I thought his deconstruction of the observed arrangements of legumes on various types of dinnerware was erudite, compelling, and rationally unchallengeable.

What a ridiculous wankfest.

I find it pretty funny that the comments on his blog are longer (big surprise), more intelligent, and far more critical of his ideas than the comments in this thread.

1) Thank goodness most MeFi comments aren't needlessly longwinded. 2) Based on this FPP, I don't trust your standards of intelligence. 3) I don't feel the need to spend time criticizing a bad smell once I've recognized it's source as a steaming pile of shit.
posted by pgautier at 9:58 PM on October 29, 2007


No, honestly -- I'm reading that whole Dawkins series right now, and it's interesting and well-written. I can't believe all of you hate it so much.
posted by creasy boy at 1:09 AM on October 30, 2007


All blog entries should be as short and concise as eBay feedbacks.


Verbose but slightly interesting deconstruction of religion. Would not read again!!!
posted by flippant at 2:14 AM on October 30, 2007


Am I the only one who keeps reading this and thinking of young Peter Wiggin?
posted by Greg Nog at 4:47 AM on October 30, 2007


aeschenkarnos, Chuckles, the entire genetic code is contained within a cell right?

Presumably, one could enumerate this code, as a string of digits.

Likewise, I could enumerate the works of Shakespeare as a sequence of characters and spaces, and disregard any inherit meaning. A work of English literature, like Macbeth say, is not just a sequence of characters (digits), but it necessarily is a sequence of characters.

In the case of the genetic code, we approach the limits of understanding immediately. We can never fully 'understand' this code. Psychologically, we do not have ability to internalize complexity of this scale.

It's like showing a koala an excerpt of Hamlet and demanding an explanation- we will not get a cogent response.

However, this does not prevent us from doing so.
posted by kuatto at 12:20 PM on October 30, 2007


I'm reading that whole Dawkins series right now, and it's interesting and well-written.

Ah, yes, but the interesting parts aren't well written and the well written parts aren't interesting.
posted by Mental Wimp at 12:21 PM on October 30, 2007


The posts I linked to total at least 50,000 words, not even including comments. Surely you can't have read but a fraction of that to form your appraisal.

Well I was reading some more of his paper on what's wrong with CS research, and while the setup was intresting, his denial of the utility of mathematics in computer science seems to be, well, mildly retarded at best.
posted by delmoi at 12:57 PM on October 30, 2007


Wow, check this. In some commentary where he is mapping out the implicit 'caste' system in the US, and naming them (Brahmins, helots, etc)
In the Dalit caste, status among men is defined by power, wealth and sexual success, among women by attractiveness and popularity. The favored occupation of Dalit men is crime, preferably of the organized variety. However, Dalit criminals are not generally psychopathic; they perceive crime as guerrilla warfare against an unjust society. Dalit women may support themselves by crime, welfare (which they consider a right), or payments from men. Both male and female Dalits may occasionally support themselves by conventional employment, but this is usually in jobs that other castes (except Helots) would consider demeaning, and Dalits share this association. The Dalit caste is not monolithic; it is divided into a number of ethnic subcastes, such as African-American, Mexican, etc. A few white Dalits exist, notably in the Appalachians. There is little or no solidarity between the various Dalit ethnicities.

posted by delmoi at 1:28 PM on October 30, 2007


Didn't really get through the link, but, um, "digital" and "lossy" aren't at all two different options. Something can very easily be both or neither. The CDs on the floor of my car are extremely digital and extremely lossy. The records in my collection at home aren't either.

I didn't say they were mutually exclusive, my point was that if something is lossy, it's not "digital" in the same way we think of most things we use day to day on our computers, where bits are either on or off. Because ultimately our brains and our ideas and our words are just as "digital" as our genes, and memetic theory talks about words, ideas, etc. So to say because genes are digital, they are not like memes is not a very useful thing to say.
posted by delmoi at 1:49 PM on October 30, 2007


his denial of the utility of mathematics in computer science seems to be, well, mildly retarded at best.

I think his point is more that the things mathematicians get grants to implement are not things that are directly useful to people writing software.

I understand and approve of his distinction between Python and Haskell, Python is much more useful for the average programmer.

But I am not an average programmer, and I find Haskell very very useful, having written some seriously non-trivial programs in it — over 3000 lines after preprocessing using Generic Haskell.
posted by blasdelf at 5:40 PM on October 30, 2007


I think his point is more that the things mathematicians get grants to implement are not things that are directly useful to people writing software.

Right, and my point is that he's retarded. He seems lucid, if banal and turgid talking about computer science, but when he talks about society or even academia, it's as if he's talking about some bizarre fantasy world. I mean he literally said black people and Mexicans believed to a Caste who generally preoccupy themselves with committing crimes (and their women are all on welfare). Why in gods name would you want to listen to the opinion of someone like that on any topic?

As far as direct applicability, people in academia usually come up with ideas that are repurposed by people in practical things later on, a really good example would be something like the relational database, which existed as a form of mathematics before anyone sat down and wrote an RDBM. A lot of stuff is like that in CS. Ideas are come up with, smart people here about them and apply them in their practical work. He obviously doesn't know anything about machine learning.

As far as the racist shit, that doesn't even really need a response
posted by delmoi at 10:00 PM on October 30, 2007


« Older Marvin Digs....  |  The Johnny Cash Show 1969-1971... Newer »


This thread has been archived and is closed to new comments