Great Lakes to be filter-fed to carp
December 3, 2009 7:57 AM   Subscribe

Asian Carp update: since 2003(previously), the inexorable advance of Asian Carp up the Mississippi delta has brought them to within 6 miles of Lake Michigan. These invasive "100-pound Zebra Mussels" suck rivers clean and starve native fish. Asian Carp are now 97% of the fish biomass in the Mississippi delta. The "electric fence" across the canal didn't stop them. The poisoning of the canal won't stop them. Closing the Chicago sewage canal locks is the only way to be sure. But the Army Corps of Engineers have the jurisdiction. Feel safe?

If you are from Minnesota, Wisconsin, Illinois, Indiana, Michigan, Ohio, Pennsylvania or New York, take a minute to write your Federal representative. If the Asian Carp get into the Great Lakes, it's bye-bye Trout, Bass, Coho, Steelhead, and every fish in the $7 billion fishing industry. Now or never.
posted by anthill (66 comments total) 6 users marked this as a favorite

I think it should be pointed out that the Corps of Engineers doesn't really seem to be to blame; the Coast Guard is the one holding up activation of the barrier:
[T]he Coast Guard, which has final say on the matter, isn't convinced. The latest electricity tests in the area around the power plant were completed in April. Now the Coast Guard is considering a batch of additional tests.

"Different temperatures could reflect different results," says U.S. Coast Guard Lt. Erick R. Johnson.

A letter the Journal Sentinel obtained suggests that the Coast Guard has a history of being more interested in maintaining business-as-usual on the canal than protecting the future of a system of lakes that provide drinking water for 40 million people and sustain a commercial and recreational fishery valued at more than $7 billion a year.

After a spark arced from a barge traveling across the experimental barrier, the Coast Guard sent a letter in January 2005 asking the Corps to shut it down - leaving the door wide open to the carp - while safety tests were conducted.

The Army Corps declined, and the Coast Guard settled for a new set of common sense rules for boats operating in the barrier zone, including a lifejacket requirement and no stopping to hitch or unhitch barges in the electrified area.

There have been no new safety incidents reported, yet the studies continue.
It seems the CG are the ones who aren't exactly prioritizing the carp issue, while the CoE has actually done their job. This disconnect seems to be the source of the issue.
posted by Kadin2048 at 8:03 AM on December 3, 2009


Geez, what sort of yellow panic fish-racism is this? America for American fish? America was founded on the basis that fish from anywhere in the world could come and thrive, and become part of that melting-pot gumbo. But no, as soon as any species comes and actually does well, they get labeled "invasive" and this sort of fish-racism is just another example.
posted by explosion at 8:06 AM on December 3, 2009 [12 favorites]


explosion, that's a good idea... maybe Lou Dobbs could be convinced to endorse closing the canal?
posted by anthill at 8:09 AM on December 3, 2009


Closing the Chicago sewage canal locks is the only way to be sure.

Well, you could take off and nuke the site from orbit. It's the only way to be sure.
posted by The Bellman at 8:09 AM on December 3, 2009 [5 favorites]


Illinois State Senator Mike Jacobs also wants to expand the market for Asian carp. For one thing, he'd like to see it on the menu in state prisons.
posted by infinitefloatingbrains at 8:13 AM on December 3, 2009 [1 favorite]


Can't beat them? Eat them!

And they're supposedly somewhat tasty...maybe people *would* feel less reluctant to eat them if the name was changed.
posted by samsara at 8:18 AM on December 3, 2009


Note to readers: old articles that say "The good news: An electric barrier has kept bighead and silver carp — the two most aggressive types — from advancing beyond a lock and dam on the Illinois River, about 50 miles southwest of Chicago." are out of date. Asian Carp environmental DNA has been found above the barrier and just shy of the Lake Michigan locks.
posted by anthill at 8:19 AM on December 3, 2009


(Hah, beat me to it infinitefloatingbrains!)
posted by samsara at 8:19 AM on December 3, 2009


The Great Lakes are one of the US's and the world's greatest resources. Fresh water doesn't grow on trees. And that's apart from the fish and recreation.

Although, I will note, these coho salmon are not native. They were imported to control another invasive species. Purely a fabulous side benefit that they are so good to eat (well, at least, they were, before they got full of mercury and other fun things).

As for Senator Mike Jacobs: I'd like to see him on a state prison menu. Oh, I don't mean him being eaten. I mean him eating the same menu. I hear it can alleviate some symptoms of shirtitis.
posted by Goofyy at 8:25 AM on December 3, 2009


Sounds pretty doomed to me. Once an invasive species has this kind of a foothold, how can we possibly remove them, or really keep them out of connected waterways long-term? All we can possibly do is eat them if they're edible (or make them into fish oil supplements? feed for farmed salmon?) and preserve the fragile native species elsewhere, if possible.

Of course the US is full of invasive species that we either like or aren't aggressive at pushing out other species (or did so long ago).

We're not going to get rid of kudzu, either. Or mimosa trees. Or zebra mussels.
posted by emjaybee at 8:25 AM on December 3, 2009


Lake Michigan is already full of invasive species, mostly due to a) overfishing (goodbye trout!), b) misguided attempts to mitigate the effects of overfishing (hello salmon!), c) construction of canals (hello lampreys!), and d) shipping (hello zebra mussels!).

Couldn't you just drive a big, loud boat down the river and make all the carp jump out?
posted by Sys Rq at 8:30 AM on December 3, 2009


emjaybee: you're totally right. We can't keep them out of connected waterways, so the solution is to disconnect them. Chicago can keep dumping their sewage in the Mississippi delta, it's just the locks that need to be closed.
posted by anthill at 8:31 AM on December 3, 2009


I wonder why we don't just dump in 30,000 or so fish that soley eat the insurgent carp? Get them to train other fish to eat the carp, then withdraw them out in 18 months or so...
posted by samsara at 8:35 AM on December 3, 2009 [6 favorites]


..maybe people *would* feel less reluctant to eat them if the name was changed.

The Patagonian Toothfish agrees.
posted by jquinby at 8:36 AM on December 3, 2009 [2 favorites]


Why can't these fish be caught and be fed as feed to livestock that eat meat, like fish farms? You can just grind them up and animals are going to be far less picky about bones than humans. It's potentially more expensive than regular feed for them, but if the real goal is to reduce the population of the carp, you can partially offset your costs by selling it to farmers that can use it. Just charge them a price that makes it palatable.
posted by shen1138 at 8:38 AM on December 3, 2009


Quick question: about how many more horrific problems like this have to happen before we finally figure out that we should think really, really, really, really, really hard before moving a species from one habitat to another in order?
posted by Deathalicious at 8:41 AM on December 3, 2009


Cats are an invasive species too. Then again, cats are kinda cute.
posted by monospace at 8:45 AM on December 3, 2009


You'd think bioengineers could whip up with a virus that could exclusively wipe these bastards out.
posted by Pollomacho at 8:54 AM on December 3, 2009


I wonder why we don't just dump in 30,000 or so fish that soley eat the insurgent carp? Get them to train other fish to eat the carp, then withdraw them out in 18 months or so...

Everybody sing along!
There was an old woman who swallowed a cow,
I don't know how she swallowed a cow!
She swallowed the cow to catch the goat,
She swallowed the goat to catch the dog,
She swallowed the dog to catch the cat,
She swallowed the cat to catch the bird,
She swallowed the bird to catch the spider,
That wriggled and jiggled and tickled inside her,
She swallowed the spider to catch the fly,
I don't know why she swallowed the fly,
Perhaps she'll die.
posted by Pope Guilty at 8:55 AM on December 3, 2009 [4 favorites]


Oh, it's an Afghanistan joke. Ha ha, I'm retarded.
posted by Pope Guilty at 8:55 AM on December 3, 2009 [4 favorites]


Quick question: about how many more horrific problems like this have to happen....

Since we are ourselves an invasive species, the answer is probably "infinite".
posted by aramaic at 8:57 AM on December 3, 2009


Deathalicious, you will be shock to hear this, but in many cases with marine based invasive species their introduction into new environments is neither intentional nor a result of hubris. Very often it is due to ballast being released by cargo ships upon arrival and whatever was in those tanks finding itself halfway across the world. Such was the case with the zebra mollusks, and a personal favorite of mine coming to the Chesapeake Bay all the way from the Black Sea just to crawl through the mud and drill through out oysters the Rapana Venosa.

In many cases the best you can hope for is that the local environment can adapt (which it will in the long run, although that could be millions of years), or that people can make use of the interloper.
posted by BobbyDigital at 9:05 AM on December 3, 2009 [1 favorite]


Meanwhile, officials in Maine have been diligent about keeping the carp at bay.
posted by SteveInMaine at 9:07 AM on December 3, 2009


..maybe people *would* feel less reluctant to eat them if the name was changed.

Worked for orange roughy.
posted by applemeat at 9:12 AM on December 3, 2009 [2 favorites]


Aside from being absolutely appalled at the idea of the Great Lakes getting screwed yet again, I am left wondering... why does it seem that all the invasive species are Asian?

Just to balance things out, I hope to god that somewhere in Asia some farmer is in his field cursing about the goddamn American beetles eating his crop.
posted by caution live frogs at 9:16 AM on December 3, 2009


Cats are an invasive species too. Then again, cats are kinda cute.

The birds of Macquarie Island disagree. Or at least they don't value the cuteness of cats like you do.
posted by filthy light thief at 9:17 AM on December 3, 2009


Deathalicious, we should strive to be responsible, but in the long run, importing invasive species is not strictly "horrific" just unfortunate for the species that get pushed out (and us, if we like/need those species). And as others pointed out, some of those species pushed out by carp are not native either. Just species we happen to find more valuable.

We are part of nature; one of the evolved tendencies of our species is both to move around and to take other useful or desirable species (plants or animals) with us. We are also only recently capable of noticing what kind of effects this has on the existing environment, as well as the greatly increased speed with which these effects occur now.

I guess I am trying to get at the idea that chest-beating is useless, as are ideas about the "purity" of an existing ecosystem. Because even when we make and enforce laws, accidental invasions happen. We can't set up truly impermeable barriers in natural systems. What barriers do exist are accidents of geology. But there is this strain in environmentalism that takes existing ecosytems as some sort of perfection that must be preserved, and that bothers me. Sometimes it seems like our guilt over all the extinctions we've caused makes us think that whatever remains in nature must be preserved exactly as it is forever, which seems to ignore that we ourselves are one of the forces of change existing in nature. We just have the bad luck to be self-aware, unlike continental drift.

We can focus on good stewardship of existing systems, reducing pollution, and ending direct extinctions by development or consumption, all of which are under our control. Unlike the ability of an accidentally imported species to thrive in a new environment, which in the long run, isn't.

/possibly overly nuanced take on this conversation
posted by emjaybee at 9:19 AM on December 3, 2009 [3 favorites]


"Contain Invasive Species" is pretty vague and has no clear course of action, which suggests that people will not pay attention, and tend to procrastinate.

The good news on the Asian Carp is that there's just one way they can get in the Great Lakes. Through the Chicago Diversion canal. Close that waterway, fish stop. End of problem.
posted by anthill at 9:47 AM on December 3, 2009


Audio from a segment on this from Chicago Public Radio's Eight Forty-Eight this morning is available online. As far as I could tell, closing the canal would disrupt gravel barges going to northwest Indiana. It is a good segment if you care about this.
posted by cgk at 10:00 AM on December 3, 2009


I am left wondering... why does it seem that all the invasive species are Asian?

Because you're not in Asia.

Their potential for native species displacement aside, one of the most fascinating things about the Asian silver carp is their ability to leap up to 10' out of the water. They leap as a defense mechanism. Unfortunately, being somewhat skittish fish, the churn from even a small outboard motor is enough to get them hopping. As getting smacked with a large airborne fish is no idle matter, the US Fish & Wildlife Service warns that "collisions between boaters and jumping silver carp have the potential to cause human fatalities". No one has died yet, but bones have been broken.
posted by jamaro at 10:03 AM on December 3, 2009 [1 favorite]


Also: Michigan Governor Jennifer Granholm made news yesterday when she said the fish kill won’t be enough of a deterrent against the carp. Granholm wrote a letter asking her state’s Attorney General to consider suing Illinois and the U.S. Army Corps of Engineers with the possible goal of permanently closing the canal. A report on the possibility of closing the canal is available from the Alliance for the Great Lakes.
posted by cgk at 10:04 AM on December 3, 2009


As far as I could tell, closing the canal would disrupt gravel barges going to northwest Indiana.

And, as we all know, Indiana is in the midst of an historic gravel shortage, and there is no other way to transport it.
posted by Sys Rq at 10:06 AM on December 3, 2009 [4 favorites]


I'm going to go out on a limb as the devil's advocate here and ask, if it weren't for invasive species, would there be much biodiversity in the first place from oak trees to AIDS virus? Look at humans, were all some African species that spread out of the rift valley. All species have to point back to some individual evolutionary step that allowed them some sort of advantage and led them to propogate and spread or, alternately, that prevented them from being overun or lost due to a changed environment.
posted by Pollomacho at 10:37 AM on December 3, 2009


I am left wondering... why does it seem that all the invasive species are Asian?

Because you're not in Asia.


Yeah, North America gets the Asian Snakehead and Asia gets the... guppy.
posted by keep_evolving at 10:48 AM on December 3, 2009


and Asia gets the... guppy.

Sure, spoken like a species who has never been sexually harassed by a guppy. Those little bastards never give up.
posted by jamaro at 10:54 AM on December 3, 2009


Cats are an invasive species too. Then again, cats are kinda cute delicious.
posted by Baby_Balrog at 11:02 AM on December 3, 2009 [1 favorite]


caution live frongs: Aside from being absolutely appalled at the idea of the Great Lakes getting screwed yet again, I am left wondering... why does it seem that all the invasive species are Asian?

Just to balance things out, I hope to god that somewhere in Asia some farmer is in his field cursing about the goddamn American beetles eating his crop.


Actually, we got 'em back with bluegills. From the article: "In some locations where it has been transplanted, it is considered a pest: trade in the species is prohibited in Germany and Japan. In the case of Japan, bluegill were presented to the crown prince, Akihito in 1960 as a gift by Richard J. Daley, mayor of Chicago. The prince, in turn, donated the fish to fishery research agencies in Japan from which they escaped, becoming an invasive species which has wreaked havoc with native species. The emperor has apologized.[1]"

Of course, as a native Michigander, I think bluegills are completely delicious. But then I spit them over a hickory fire. Dunno how they'd taste as sashimi.
posted by Baby_Balrog at 11:05 AM on December 3, 2009


Singing the story — “the carp are coming” (Boiled In Lead)
posted by omnidrew at 11:15 AM on December 3, 2009


I had an interesting conversation with a friend of mine in Beijing a couple of years ago. I was bitching to him about the terrible asian tiger mosquito spreading across America, he in turn bitched about the giant North American mosquitoes spreading across Asia.
posted by Pollomacho at 11:31 AM on December 3, 2009


I am shocked that no one has figured out the sporting potential of these fish, especially in southern states. Load a boat full of shotgun-bearing good ol' boys and drive up the Mississippi at full speed. It's like skeet-shooting on steroids. Probably will get a little messy but that's never stopped Americans before.
posted by Ber at 11:37 AM on December 3, 2009 [1 favorite]


Sorry, but when I hear about "Giant Carp", I think of this. (video link may not be accessible everywhere. SPOILER: It's the WKRP carp mascot - has the Asian Carp made it up the Ohio River to Cincinatti yet?)
posted by oneswellfoop at 11:41 AM on December 3, 2009


Ber, behold, Extreme Aerial Bowfishing [warning, autoplay music and the cackling of good ol' boys].
posted by jamaro at 11:43 AM on December 3, 2009


Actually, we got 'em back with bluegills

I have a special place in my heart for bluegills. Not just because a large part of the research done on them has been done where I work, but because they have one of the coolest mating systems ever.

The first kind of male builds a nest and attracts a female like a normal guy should. BUT there are also 'sneaker' males. These guys are smaller, and suck at building nests so they wait around and when they see a female enter a nest they dart in and have their way with the female and her eggs before the guy who's nest it is even has a chance.

But wait, there's also a third type of male, the 'satellite' male. These guys grow up to look like females. The sneak into the nests of normal males, pretending to be female. While the nesting male thinks he's awesome and has this big harem, there's actually another male in there knocking up his women.

When I get frustrated with how complicated I think human relationships can be I just think of the bluegill and I feel better.
posted by Midnight Rambler at 11:47 AM on December 3, 2009 [16 favorites]


What you said: Asian Carp are now 97% of the fish biomass in the Mississippi delta.

From the 97% of the fish biomass link: A survey in an offshoot of the Mississippi River near St. Louis found 97 percent of the fish were Asian carp.

I'm citing you for both sloppy geography and inappropriate use of the word "biomass."
posted by Panjandrum at 11:51 AM on December 3, 2009 [2 favorites]


i don't think closing the canal is going to make a difference. the isthmus between the watersheds is pretty low, and subject to flooding--made worse by the general urbanization of the area.

the section of the canal were they have the barrier is parallel to the des plaines river, which, as part of the mississippi watershed, drains most of chicagoland. if they just close the locks at lake michigan, those fish can get really close. i'm sure there's some locks between romeoville and downtown, but if they cut that, then the chicago river has to go into the lake. that, too could eventually become a path for the fish because of the flooding that's common in the area.

the 'closing of the chicago sewer locks' link above talks about a system of berms to address this issue. that would help delay things, but they need to be building them now, not when the electrical barrier/fish kill plans fail.
posted by lester's sock puppet at 12:04 PM on December 3, 2009


I'm citing you for both sloppy geography and inappropriate use of the word "biomass."

The ceremonial punishment for such a citation.
posted by Pollomacho at 12:30 PM on December 3, 2009


I'm wondering just how "invasive" these fish are. The video link says they were imported into the US by catfish farmers to help clean out catfish ponds. Floods then (naturally) dispersed them into rivers. Would we expect them to return to the ponds? Maybe this "invasion" is really a massive jailbreak, and they're swimming back to Carpathia.
posted by Partial Panel at 12:57 PM on December 3, 2009


Can't beat them? Eat them!

And they're supposedly somewhat tasty...maybe people *would* feel less reluctant to eat them if the name was changed.


I think the gripe on these guys is that they have lots of loosely- (or un-) attached bones, which makes them unattractive to bone-skittish, filet-loving americans. whatevs. sounds great to me, with scallions, ginger and sesame oil.

concerning the problem of their massiveness, combined with jumping, I think that's a feature. suwannee river sturgeon, a protected species that grows to gargantuan dimensions, does the same thing, and their jumping is a not-uncommon cause of traumatic death, drowning or severe injury. can I say for sure that their known presence is a deterrent to manatee-murdering yahoos who ordinarily wouldn't moderate their boat speed in the river? can't prove it. but I like to think so.
posted by toodleydoodley at 1:10 PM on December 3, 2009


I think the gripe on these guys is that they have lots of loosely- (or un-) attached bones, which makes them unattractive to bone-skittish, filet-loving americans. whatevs. sounds great to me, with scallions, ginger and sesame oil.

Yeah, we don't quite have the whole spitting bones on the floor/sticking your fingers in your mouth type thing going on at the dinner table over here. It's too bad because a big ol' whole carp done up all fancy-like is some good eatin'.
posted by Pollomacho at 1:26 PM on December 3, 2009


I'm going to go out on a limb as the devil's advocate here and ask, if it weren't for invasive species, would there be much biodiversity in the first place from oak trees to AIDS virus?

Of course there would be biodiversity- all the diversity that existed before humans created transportation systems that moved species around quickly would still exist.

. Invasive species are invasive because they suddenly show up in an ecosystem that has no natural checks on their expansion, like predators or pathogens that attack them. The ecosystem is then destabilized, and relationships between flora and fauna that evolved over eons are thrown out of wack. For example, the fire regime in certain ecosystems has been significantly altered by invasive cheatgrass. It creates more fuel for fires than normally exists in the habitat it's invaded. It is a fire following plant, and responds very well to fires, when the native grasses do not. Cheatgrass produces more carbon than the biome it has invaded can process, and now parts of the Great Basin have shifted from being carbon sinks to carbon sources. The biome that previously existed as a sustainable system (inputs=outputs, basically), is no longer sustainable. Could something else come along to use the excess carbon, and withstand the new, more frequent, and hotter fires? Probably at some point, but the old habitat, along with many of the species it supported would be changed. There are many, many biomes that have become less diverse due to invasive species.

Here's one example in my state that actually is bad for invasive species: the California Buckeye (Aesculus californica) is pollinated by native honeybees. It's also visited by non native/invasive* European honeybees. Unfortunately, the pollen is toxic to European bees, though the bees, butterflies, and birds that co-evolved with the buckeye are immune to the toxin. This is good for the buckeye, as it can still have its genetic material spread around, and good for the species that evolved an immunity to the toxins and can eat the pollen.
posted by oneirodynia at 2:01 PM on December 3, 2009 [1 favorite]


Now or never.

My guess, based on past performance of humans, is on "never." Good bye, Great Lakes fisheries.

Sigh.
posted by five fresh fish at 2:04 PM on December 3, 2009


Dammit, I was working on a post about this as a follow up to the big fish kill yesterday. For what it's worth...

Wednesday night, a six mile stretch of the Chicago Sanitary & Ship Canal was poisoned with the fish toxin rotenone, as the latest step in the ongoing fight to keep invasive Asian Carp out of the Great Lakes. Now begins the work of cleaning up 200,000 pounds of dead fish.

With the Chicago Sanitary & Ship Canal being the only hydraulic route to the Great Lakes, a set of electrical barriers were constructed in the canal by the Army Corps of Engineers, beginning in 2002. Yet, with only one barrier currently capable of blocking all sizes of fish until late 2010, and Asian Carp DNA detected just downstream, a necessary maintenance shutdown could not be performed without backup protection. Hence the rotenone.

But are we already too late? Asian Carp DNA was recently detected upstream of the barriers, just 7 miles from Lake Michigan (although no actual fish can be found). Individual Asian Carps have occasionally been caught in Lake Erie since 1995, as well.

What’s more, a large flood could serve as a back-door around the electrical barriers. And what’s to stop a fool from releasing a live fish in the name of art?
posted by gueneverey at 3:26 PM on December 3, 2009


Panjandrum: You're right, I was off by a few percentage points, and I chose a poor reference. I stand by the statement.

SciAm: The omnivorous fish ... make up 95 percent of the biomass in sections of the Illinois River. | Gary Towns of the Michigan DNR fisheries division said ... "The Illinois River now, about 90 percent of its biomass or the pounds of fish collectively in the stream is made of these Asian carp" | Local TV station: Near Peoria, Asian carp make up 95% of the river's biomass.

Carp filter-feed plankton. Everything else eats plankton. That means that when the carp move in, the microscopic critters die, then the insects die, then the minnows die, then the sport fish die, not to mention everything else that doesn't get counted in the national GDP.

I'm wearing my heart on my sleeve here, I know, but there's not much that a Canadian can do about this situation. The Coast Guard doesn't pick up the phone when we call.
posted by anthill at 3:34 PM on December 3, 2009


Skinner: Well, I was wrong; the lizards are a godsend.
Lisa: But isn't that a bit short-sighted? What happens when we're overrun by lizards?
Skinner: No problem. We simply release wave after wave of Chinese needle snakes. They'll wipe out the lizards.
Lisa: But aren't the snakes even worse?
Skinner: Yes, but we're prepared for that. We've lined up a fabulous type of gorilla that thrives on snake meat.
Lisa: But then we're stuck with gorillas!
Skinner: No, that's the beautiful part. When wintertime rolls around, the gorillas simply freeze to death.
posted by 445supermag at 7:22 PM on December 3, 2009


Weird things about this story:

1. Why do they keep saying that they detected carp DNA but can't find any live carp? What the hell kind of DNA did they detect? Did they find like a piece of a fish or something? I don't understand how they are "scanning" the water for random carp DNA particles.

2. Why are there Fisheries Canada personnel working on this? I mean, I assume they're worried about the lakes and all, but isn't there some kind of jurisdictional problem here? Has anyone told Lou Dobbs?
posted by Mid at 8:12 PM on December 3, 2009


Isn't harvesting them the obvious solution?
posted by From Bklyn at 12:55 AM on December 4, 2009


Mid--

PCR works by basically saying "Find a genetic sequence that begins with AAAACCCCTTTTGGGGACACCTCTCTTGTG, copy it for a while, and then stop when you hit a stopping point."

So, if you take a ton of loose DNA (which you can get by spinning biomass in a centrifuge), if you then throw in suitably configured PCR, you'll get a ton more generated if the matching sequence exists.
posted by effugas at 2:15 AM on December 4, 2009


Why can't these fish be caught? You can't catch them. They are really sensitive to vibrations, so you can't net them, and they don't take normal bait on a hook and line. Sometimes fishermen trying to catch carp using potatos as bait catch them by accident. That in itself is sad - potato is the only bait on which you can catch these by accident... so sad... so very sad...

Some knuckleheaded fishieries minister here in Hungary introduced them (they are called Busa in Hungarian) to Lake Balaton in the 1960s for sport fishermen, which didn't work out too well since they won't take bait and they bolt as soon as they sense the vibrations of a fishing boat, and now we have these huge carpoid monsters gobbling up all the vegetation that other fish need to breed in. These things are like Volkswagens with scales, only hungrier than a VW and short of draining a lake they can't be caught.

Isn't harvesting them the obvious solution? Here in Hungary they are occaisionally eaten, but I've tried the meat and it is pretty horrid - kind of like a soft greasy fishy gel with lots of hidden Y-shaped bones. You wouldn't feed this stuff to prisoners.

These are bad fish, and I hate them. I hate all carp. Silver Carp, Crucian carp, common carp, Asian Grass carp...I hate them and all all their Cyprinidae brethren. I hate carp. I really do. They are the Fish of the Damned. Please kill them... every last one of them... please....
posted by zaelic at 3:34 AM on December 4, 2009


Actually, we got 'em back with bluegills

The problem with introduced fish is that you can never tell what kind of weird Frankenfish they will become. In Europe (I live in Hungary) sunfish and bluegills never grow to the size they do in the US. Only pike can act as predators, so they overpopulate lakes and grow into stunted little fish that compete for food with native species and are not worth fishing for. Same thing for Largemouth bass - local fishermen would love to fish for those lunkers but they never seem to grow bigger than a sunfish. Bullhead catfish are a huge problem in Hungary - they never grow larger than six inches, making them worthless as a food source, but they breed so fast that they push out all other species within a year.

I'm a catch and release trout fly fisherman, so these things get me a bit emotional...
posted by zaelic at 4:28 AM on December 4, 2009


They just poisoned a shitload of them. "some may be the feared Asian carp." Sure--what's 200,000 pounds of poisoned fish when you may have actually killed some of the ones you were aiming for?
posted by proscriptus at 6:02 AM on December 4, 2009 [1 favorite]


A breeding pair of the ones you were looking for, not in North America's largest freshwater body?
posted by anthill at 6:31 AM on December 4, 2009


Mid: DNA from fish poo, fish goo, fish scales... These things poop continuously and generate slime as a defense mechanism, so they're not that stealthy.
posted by anthill at 6:33 AM on December 4, 2009


proscriptus, reports here in chicago indicate that out of all the fish they killed, only 1 was an asian carp.

after commenting last night, i looked over the ariel photos of the areas. there are no locks between this fish barrier and the lake, except the one in downtown chicago. i'd bet money that the carp have already found their way into lake michigan.
posted by lester's sock puppet at 8:39 AM on December 4, 2009


These hearty, large, delicious fish are taking over *and* they jump out of the water into your boat for you?

What's the issue?
posted by godisdad at 9:59 AM on December 4, 2009


“But no, as soon as any species comes and actually does well, they get labeled "invasive" and this sort of fish-racism is just another example.”
Yeah, what’s disgusting is all the Asian fish fetishes. Perverts going around dressing them in school girl sailor suits. Don’t get me started on the manga.
posted by Smedleyman at 4:52 PM on December 4, 2009


Well, hell, now y'all got the Canadians involved.
posted by five fresh fish at 9:17 AM on December 5, 2009


« Older Box 5-1438: Report of a structure fire at 266 Fran...  |  8 Million Reasons for Real Sur... Newer »


This thread has been archived and is closed to new comments