Does the string “…CATCAT…” appear in the DNA of Felis catus?

October 13, 2016 12:12 PM

Well, does it?
posted by Foci for Analysis (20 comments total)

It's hard to believe it wouldn't. With tens of millions of pairs, and the target string only being 6 long, I would wager that every possible 6-codon sequence appears at least once.
posted by Chocolate Pickle at 12:46 PM on October 13, 2016 [2 favorites]

Also, if you look at the human genome, you'll find the sequence:

GATTACA

Coincidence? I think not.
posted by leotrotsky at 12:49 PM on October 13, 2016 [7 favorites]

The real question is, does the short tandem repeat sequence CATCAT....CAT appear more often than statistically likely. I think I already have a Perl script for this that I could modify...
posted by Made of Star Stuff at 12:53 PM on October 13, 2016

Expand to amino acid sequences in the many fabulous transcriptomes published in the last decade and I bet we could get MNKEY, ELEFANT, FLY....
posted by Made of Star Stuff at 12:58 PM on October 13, 2016 [2 favorites]

If my math is correct, the sequence CATCAT should occur once for every 4,096 six-base sequences on average, assuming the occurrence of any one base is random.
posted by ZenMasterThis at 12:59 PM on October 13, 2016

What about the question "Does the string "...ATTACCAT..." appear in the DNA of Canis lupus familiaris?
posted by strelitzia at 1:05 PM on October 13, 2016 [3 favorites]

ATTACACAT is also acceptable.
posted by dances_with_sneetches at 1:08 PM on October 13, 2016 [2 favorites]

One of the comments is "If the bases were called adenine, bytosine, cuanine and dymine, then you would have BADBADBAD. If they were called qurine, quadrium, quitterium and quinterone, then you'd have QQQQQQQQQ. And so on. By renaming them, you can make up any short word containing only four different letters, and find it in whichever chromosome of whichever animal you want - for example you could make the human Y chromosome contains "MENS".

You could also make it contain MENSES, which would be funnier.
posted by nickmark at 1:08 PM on October 13, 2016 [5 favorites]

OKAY NOW GET TO WORK CRACKING THE BIBLE CODE
posted by chavenet at 1:15 PM on October 13, 2016 [1 favorite]

With tens of millions of pairs, and the target string only being 6 long, I would wager that every possible 6-codon sequence appears at least once.

DNA isn't just a random sequence of letters. It has structure and certain sequences would be highly unstable.
posted by dilaudid at 1:17 PM on October 13, 2016

But does 'CAT' appear more in the DNA of F. cattus than in, say, dogs or horseflies or geraniums? That would be the real test.
posted by acb at 1:18 PM on October 13, 2016 [1 favorite]

Dilaudid, some of it has structure and contains information. Most of it is "trash", left over stuff no longer used, or junk incorporated by retroviruses. All the stuff which isn't used is subject to mutation and copying errors and changes don't get filtered by evolution.
posted by Chocolate Pickle at 1:42 PM on October 13, 2016

All the stuff which isn't used is subject to mutation and copying errors and changes don't get filtered by evolution.

Not necessarily; certain sequences have inherently unstable geometries and are more likely to be copied inaccurately. For example, runs of a single nucleotide in non-coding regions is quite polymorphic between individuals because it's easy to add an extra one or lose a nucleotide.

There are some arguments that non-coding and non-standard-regulation sequences are still subject to selective control; a lot of "junk" DNA is structural - changes the 3D shape of adjacent (or even very remote) DNA affecting its accessibility for transcription, and the 3D shape can be influenced by many different DNA binding proteins (or even epigenetic methylation) that can be different between different cell types from the same organism.

There's also fairly heterogeneous codon usage between different organisms (very obvious especially in microorganisms, but - for example - codon usage frequency in humans and mice are different and contributes to different G/C content as well as nucleotide distribution) for a variety of reasons.
posted by porpoise at 2:03 PM on October 13, 2016 [9 favorites]

in which we learn patterns in genetic code "constitute invincible evidence of the truth of the Judeo-Christian Scriptures". For instance, get this, the "total nucleons in the B-component of paired A codons" is 666. BAM. (note: pleasant, low key layout on the site; professional, even)

(I found this site while trying to find a chart to show me what amino acid CAT, ATC, or TCA code for)
posted by the antecedent of that pronoun at 2:10 PM on October 13, 2016 [2 favorites]

The sequence "CATCATCATCATCATCATCATCATCATCAT" shows up in a huge number of places in the cat genome, according to NCBI BLAST. I did compare it against the remainder of the world's known sequences, and the top hit was for Raphanus sativus... AKA the radish.
posted by caution live frogs at 2:36 PM on October 13, 2016 [4 favorites]

The sequence "CATCATCATCATCATCATCATCATCATCAT" shows up in a huge number of places in the cat genome

That's just in case you're still confused, I guess.
posted by rokusan at 3:15 PM on October 13, 2016 [1 favorite]

I'm not at all ashamed that as soon as I read "felis catus", my mind went here.
posted by xedrik at 5:47 PM on October 13, 2016 [2 favorites]

My cat's breath smells like cat food.
posted by The Underpants Monster at 7:54 PM on October 13, 2016

Raise your hand if you're disappointed TACOCAT can't be in a gene sequence.
posted by tommasz at 5:18 AM on October 14, 2016 [1 favorite]

The sequence "CATCATCATCATCATCATCATCATCATCAT" shows up in a huge number of places in the cat genome, according to NCBI BLAST. I did compare it against the remainder of the world's known sequences, and the top hit was for Raphanus sativus... AKA the radish.
posted by caution live frogs at 5:36 PM on October 13

And behold, a cat made of radish. How many extra CATCATCATCATs is that?
posted by rmless at 1:21 PM on October 14, 2016